Incidental Mutation 'R0060:Eps8l3'
ID201400
Institutional Source Beutler Lab
Gene Symbol Eps8l3
Ensembl Gene ENSMUSG00000040600
Gene NameEPS8-like 3
Synonyms
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R0060 (G1)
Quality Score20
Status Validated
Chromosome3
Chromosomal Location107877229-107892900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107879541 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 11 (L11S)
Ref Sequence ENSEMBL: ENSMUSP00000042004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037375] [ENSMUST00000199990]
Predicted Effect probably damaging
Transcript: ENSMUST00000037375
AA Change: L11S

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042004
Gene: ENSMUSG00000040600
AA Change: L11S

DomainStartEndE-ValueType
Pfam:PTB 28 155 3.7e-40 PFAM
low complexity region 204 214 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
SH3 460 515 5.19e-15 SMART
PDB:2E8M|A 516 582 3e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196102
Predicted Effect probably benign
Transcript: ENSMUST00000199990
SMART Domains Protein: ENSMUSP00000143754
Gene: ENSMUSG00000040600

DomainStartEndE-ValueType
Pfam:PTB 1 88 8.2e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200198
Meta Mutation Damage Score 0.088 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. Alternatively spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Eps8l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Eps8l3 APN 3 107881171 missense probably damaging 0.97
IGL01694:Eps8l3 APN 3 107892308 missense probably damaging 1.00
IGL02748:Eps8l3 APN 3 107879368 intron probably benign
PIT1430001:Eps8l3 UTSW 3 107884867 missense probably damaging 1.00
R0060:Eps8l3 UTSW 3 107879541 missense probably damaging 0.98
R0517:Eps8l3 UTSW 3 107883460 missense probably benign
R0555:Eps8l3 UTSW 3 107892345 missense probably benign
R0585:Eps8l3 UTSW 3 107881197 missense probably damaging 0.99
R0646:Eps8l3 UTSW 3 107884810 missense probably damaging 1.00
R0741:Eps8l3 UTSW 3 107882825 missense probably benign
R1682:Eps8l3 UTSW 3 107891306 missense possibly damaging 0.82
R1844:Eps8l3 UTSW 3 107879586 missense possibly damaging 0.95
R1900:Eps8l3 UTSW 3 107890952 missense probably benign 0.16
R1937:Eps8l3 UTSW 3 107884392 missense probably benign 0.02
R2010:Eps8l3 UTSW 3 107879372 start codon destroyed probably null 1.00
R2973:Eps8l3 UTSW 3 107891328 missense probably damaging 1.00
R4369:Eps8l3 UTSW 3 107891014 missense possibly damaging 0.95
R4803:Eps8l3 UTSW 3 107891009 missense probably damaging 1.00
R4926:Eps8l3 UTSW 3 107890688 splice site probably benign
R5420:Eps8l3 UTSW 3 107883985 nonsense probably null
R5580:Eps8l3 UTSW 3 107881603 missense probably damaging 1.00
R5593:Eps8l3 UTSW 3 107891188 unclassified probably benign
R5699:Eps8l3 UTSW 3 107879579 missense probably benign 0.06
R5705:Eps8l3 UTSW 3 107891264 missense probably benign 0.01
R5972:Eps8l3 UTSW 3 107884447 splice site probably null
R6250:Eps8l3 UTSW 3 107890465 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGCAGCAGAGCCATCTACTGTAAG -3'
(R):5'- TGCCCACCCTGGAACTATCCTATAC -3'

Sequencing Primer
(F):5'- AGAGCCATCTACTGTAAGCTTCC -3'
(R):5'- GGTCTCAAGATAGGTAAGTCTGACTC -3'
Posted On2014-06-06