Incidental Mutation 'R0060:Zcchc4'
ID201401
Institutional Source Beutler Lab
Gene Symbol Zcchc4
Ensembl Gene ENSMUSG00000029179
Gene Namezinc finger, CCHC domain containing 4
Synonyms4930449I23Rik
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R0060 (G1)
Quality Score61
Status Validated
Chromosome5
Chromosomal Location52775409-52824665 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52807078 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 292 (I292N)
Ref Sequence ENSEMBL: ENSMUSP00000109537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031077] [ENSMUST00000113904]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031077
AA Change: I292N

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031077
Gene: ENSMUSG00000029179
AA Change: I292N

DomainStartEndE-ValueType
Pfam:zf-GRF 37 81 2.9e-19 PFAM
Pfam:N6-adenineMlase 168 337 5.1e-11 PFAM
ZnF_C2HC 442 458 1.27e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113901
SMART Domains Protein: ENSMUSP00000109534
Gene: ENSMUSG00000029179

DomainStartEndE-ValueType
ZnF_C2HC 226 242 1.27e-2 SMART
low complexity region 248 266 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113904
AA Change: I292N

PolyPhen 2 Score 0.670 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109537
Gene: ENSMUSG00000029179
AA Change: I292N

DomainStartEndE-ValueType
Pfam:zf-GRF 37 81 2.4e-17 PFAM
Pfam:N6-adenineMlase 168 338 7.1e-11 PFAM
ZnF_C2HC 442 458 1.27e-2 SMART
low complexity region 464 482 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143745
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149612
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Other mutations in Zcchc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Zcchc4 APN 5 52816169 missense probably benign 0.05
IGL00953:Zcchc4 APN 5 52808296 missense probably damaging 1.00
IGL01860:Zcchc4 APN 5 52808356 missense probably damaging 1.00
IGL02248:Zcchc4 APN 5 52796076 missense probably damaging 1.00
IGL02536:Zcchc4 APN 5 52808316 missense probably damaging 1.00
R0060:Zcchc4 UTSW 5 52807078 missense possibly damaging 0.67
R0573:Zcchc4 UTSW 5 52795979 missense probably damaging 1.00
R0634:Zcchc4 UTSW 5 52783208 missense probably benign 0.15
R1353:Zcchc4 UTSW 5 52807077 missense probably benign 0.03
R1791:Zcchc4 UTSW 5 52796590 missense probably damaging 1.00
R1854:Zcchc4 UTSW 5 52815826 missense probably damaging 1.00
R2108:Zcchc4 UTSW 5 52796132 missense probably damaging 0.99
R2696:Zcchc4 UTSW 5 52796231 missense probably damaging 1.00
R2991:Zcchc4 UTSW 5 52804438 missense probably damaging 1.00
R3894:Zcchc4 UTSW 5 52784100 missense probably damaging 1.00
R4523:Zcchc4 UTSW 5 52784067 missense probably damaging 1.00
R4672:Zcchc4 UTSW 5 52796605 missense probably benign 0.00
R4772:Zcchc4 UTSW 5 52796207 missense possibly damaging 0.83
R4905:Zcchc4 UTSW 5 52796650 missense probably damaging 1.00
R4954:Zcchc4 UTSW 5 52819217 missense probably damaging 1.00
R5093:Zcchc4 UTSW 5 52796610 missense probably benign 0.38
R5371:Zcchc4 UTSW 5 52785170 missense probably benign 0.19
R5401:Zcchc4 UTSW 5 52807077 missense probably benign 0.03
R5755:Zcchc4 UTSW 5 52816169 missense probably benign 0.00
R6110:Zcchc4 UTSW 5 52796144 missense possibly damaging 0.95
R6244:Zcchc4 UTSW 5 52783161 missense probably benign 0.00
R6465:Zcchc4 UTSW 5 52819276 missense probably benign 0.03
R6906:Zcchc4 UTSW 5 52823634 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AACCTGCTTATCAAGGAACCCGAAG -3'
(R):5'- TTTACAGAGAGCCCAGAGCTGCAC -3'

Sequencing Primer
(F):5'- ACGTTTTCCAGTGAGACCAG -3'
(R):5'- GCACACTCCGTAACTGCTAGG -3'
Posted On2014-06-06