Incidental Mutation 'R0060:Prdm8'
ID201402
Institutional Source Beutler Lab
Gene Symbol Prdm8
Ensembl Gene ENSMUSG00000035456
Gene NamePR domain containing 8
Synonyms
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0060 (G1)
Quality Score27
Status Validated
Chromosome5
Chromosomal Location98167198-98188991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 98185260 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 229 (F229I)
Ref Sequence ENSEMBL: ENSMUSP00000147333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112959] [ENSMUST00000210477]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000057889
Predicted Effect probably benign
Transcript: ENSMUST00000112959
AA Change: F229I

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108583
Gene: ENSMUSG00000035456
AA Change: F229I

DomainStartEndE-ValueType
SET 20 137 1.55e0 SMART
ZnF_C2H2 154 182 2.37e2 SMART
low complexity region 192 219 N/A INTRINSIC
low complexity region 275 291 N/A INTRINSIC
low complexity region 315 332 N/A INTRINSIC
low complexity region 397 427 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
low complexity region 556 570 N/A INTRINSIC
low complexity region 599 621 N/A INTRINSIC
ZnF_C2H2 624 646 9.22e0 SMART
ZnF_C2H2 665 687 1.2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197382
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198172
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205851
Predicted Effect probably benign
Transcript: ENSMUST00000210477
AA Change: F229I

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a conserved family of histone methyltransferases that predominantly act as negative regulators of transcription. The encoded protein contains an N-terminal Su(var)3-9, Enhancer-of-zeste, and Trithorax (SET) domain and a double zinc-finger domain. Knockout of this gene in mouse results in mistargeting by neurons of the dorsal telencephalon, abnormal itch-like behavior, and impaired differentiation of rod bipolar cells. In humans, the protein has been shown to interact with the phosphatase laforin and the ubiquitin ligase malin, which regulate glycogen construction in the cytoplasm. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature termination of corticopsinal motor neuron axons, absent corpus callosum and hippocampal commissure, excessive scratching, skin lesions, and contraction of hindpaws resulting a handstand phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Prdm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Prdm8 APN 5 98183343 missense probably damaging 1.00
IGL02208:Prdm8 APN 5 98183465 missense possibly damaging 0.93
IGL02676:Prdm8 APN 5 98186559 missense probably damaging 1.00
R0063:Prdm8 UTSW 5 98184594 missense probably damaging 0.98
R0063:Prdm8 UTSW 5 98184594 missense probably damaging 0.98
R0630:Prdm8 UTSW 5 98184521 missense probably damaging 1.00
R1099:Prdm8 UTSW 5 98183502 missense probably damaging 0.99
R4373:Prdm8 UTSW 5 98186508 missense probably damaging 1.00
R4643:Prdm8 UTSW 5 98184587 missense possibly damaging 0.61
R4936:Prdm8 UTSW 5 98185022 critical splice acceptor site probably null
R4936:Prdm8 UTSW 5 98185023 critical splice acceptor site probably null
R5033:Prdm8 UTSW 5 98185212 nonsense probably null
R5495:Prdm8 UTSW 5 98185306 missense possibly damaging 0.62
R6307:Prdm8 UTSW 5 98185303 missense possibly damaging 0.84
R6562:Prdm8 UTSW 5 98183343 missense possibly damaging 0.82
R6970:Prdm8 UTSW 5 98184612 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GACTTCACAGCACTGATGCGAATCC -3'
(R):5'- TGGGAACCGCCTCTTGCCTTTG -3'

Sequencing Primer
(F):5'- TGATGCGAATCCCCAAGACG -3'
(R):5'- gactcagctccgcctcc -3'
Posted On2014-06-06