Incidental Mutation 'R0060:Arnt2'
ID201404
Institutional Source Beutler Lab
Gene Symbol Arnt2
Ensembl Gene ENSMUSG00000015709
Gene Namearyl hydrocarbon receptor nuclear translocator 2
SynonymsbHLHe1
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0060 (G1)
Quality Score54
Status Validated
Chromosome7
Chromosomal Location84246278-84410176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84347530 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 63 (R63C)
Ref Sequence ENSEMBL: ENSMUSP00000146599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085077] [ENSMUST00000207769] [ENSMUST00000208204] [ENSMUST00000208232] [ENSMUST00000208392] [ENSMUST00000208863] [ENSMUST00000208995] [ENSMUST00000209133]
Predicted Effect probably damaging
Transcript: ENSMUST00000085077
AA Change: R74C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082154
Gene: ENSMUSG00000015709
AA Change: R74C

DomainStartEndE-ValueType
HLH 69 122 1.42e-14 SMART
PAS 137 204 1.28e-8 SMART
low complexity region 225 236 N/A INTRINSIC
PAS 325 391 4.15e-8 SMART
PAC 398 441 7.93e-5 SMART
low complexity region 502 526 N/A INTRINSIC
low complexity region 597 626 N/A INTRINSIC
low complexity region 653 675 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207512
Predicted Effect probably damaging
Transcript: ENSMUST00000207769
AA Change: R70C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000208204
Predicted Effect probably damaging
Transcript: ENSMUST00000208232
AA Change: R63C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000208392
AA Change: R59C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208863
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000208995
AA Change: R63C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000209133
AA Change: R63C

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.89 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the basic-helix-loop-helix-Per-Arnt-Sim (bHLH-PAS) superfamily of transcription factors. The encoded protein acts as a partner for several sensor proteins of the bHLH-PAS family, forming heterodimers with the sensor proteins that bind regulatory DNA sequences in genes responsive to developmental and environmental stimuli. Under hypoxic conditions, the encoded protein complexes with hypoxia-inducible factor 1alpha in the nucleus and this complex binds to hypoxia-responsive elements in enhancers and promoters of oxygen-responsive genes. A highly similar protein in mouse forms functional complexes with both aryl hydrocarbon receptors and Single-minded proteins, suggesting additional roles for the encoded protein in the metabolism of xenobiotic compounds and the regulation of neurogenesis, respectively. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate this gene die shortly after birth, displaying impaired development of secretory neurons in the hypothalamus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Arnt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Arnt2 APN 7 84285829 missense probably benign 0.01
IGL01525:Arnt2 APN 7 84275408 missense possibly damaging 0.70
IGL02331:Arnt2 APN 7 84265624 missense probably damaging 1.00
IGL02483:Arnt2 APN 7 84251397 missense probably damaging 1.00
IGL02863:Arnt2 APN 7 84267937 missense probably damaging 1.00
IGL03207:Arnt2 APN 7 84343834 missense possibly damaging 0.93
Arnold2 UTSW 7 84347530 missense probably damaging 1.00
R0024:Arnt2 UTSW 7 84284126 missense probably benign 0.03
R0058:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0058:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0113:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0114:Arnt2 UTSW 7 84347530 missense probably damaging 1.00
R0201:Arnt2 UTSW 7 84361659 nonsense probably null
R0514:Arnt2 UTSW 7 84304859 missense probably benign 0.00
R0863:Arnt2 UTSW 7 84265584 missense probably damaging 1.00
R1800:Arnt2 UTSW 7 84275375 missense probably damaging 1.00
R1944:Arnt2 UTSW 7 84343751 missense probably benign 0.01
R1964:Arnt2 UTSW 7 84343789 missense possibly damaging 0.55
R2061:Arnt2 UTSW 7 84343870 missense probably damaging 1.00
R2216:Arnt2 UTSW 7 84275351 missense probably damaging 0.99
R3107:Arnt2 UTSW 7 84262444 missense possibly damaging 0.95
R3410:Arnt2 UTSW 7 84275447 missense probably damaging 1.00
R3739:Arnt2 UTSW 7 84343801 missense probably null 1.00
R4258:Arnt2 UTSW 7 84310955 missense probably damaging 0.98
R4486:Arnt2 UTSW 7 84275345 missense probably benign 0.03
R4489:Arnt2 UTSW 7 84275345 missense probably benign 0.03
R4668:Arnt2 UTSW 7 84275386 missense probably damaging 1.00
R5685:Arnt2 UTSW 7 84263265 missense probably benign 0.00
R5876:Arnt2 UTSW 7 84347512 missense probably damaging 1.00
R5923:Arnt2 UTSW 7 84262533 missense probably benign 0.32
R5926:Arnt2 UTSW 7 84343946 missense probably damaging 0.99
R6122:Arnt2 UTSW 7 84361565 missense probably damaging 1.00
X0066:Arnt2 UTSW 7 84285784 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCTGCCACTCTTGAAGAGTACCTCC -3'
(R):5'- TTCCATGCTCCCTGGTCAAAAGTC -3'

Sequencing Primer
(F):5'- CCTCCTTTTGAAGAATGGAAGCC -3'
(R):5'- CCCGAGTTACAGATGTGTCAG -3'
Posted On2014-06-06