Incidental Mutation 'R0060:Tmem89'
ID201409
Institutional Source Beutler Lab
Gene Symbol Tmem89
Ensembl Gene ENSMUSG00000025652
Gene Nametransmembrane protein 89
Synonyms1700024B07Rik
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R0060 (G1)
Quality Score64
Status Validated
Chromosome9
Chromosomal Location108914619-108915563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108915417 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 126 (V126D)
Ref Sequence ENSEMBL: ENSMUSP00000026744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026744] [ENSMUST00000098376] [ENSMUST00000192852]
Predicted Effect probably damaging
Transcript: ENSMUST00000026744
AA Change: V126D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026744
Gene: ENSMUSG00000025652
AA Change: V126D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM89 23 47 6.3e-16 PFAM
Pfam:TMEM89 46 166 1.1e-62 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098376
SMART Domains Protein: ENSMUSP00000095979
Gene: ENSMUSG00000023259

DomainStartEndE-ValueType
Pfam:Sulfate_transp 69 458 4.4e-113 PFAM
low complexity region 471 484 N/A INTRINSIC
PDB:3LLO|A 489 546 2e-16 PDB
low complexity region 554 593 N/A INTRINSIC
low complexity region 638 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191404
Predicted Effect probably benign
Transcript: ENSMUST00000192852
SMART Domains Protein: ENSMUSP00000142016
Gene: ENSMUSG00000025652

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:TMEM89 23 47 1.8e-15 PFAM
Pfam:TMEM89 45 118 1.3e-37 PFAM
Meta Mutation Damage Score 0.0736 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Tmem89
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0060:Tmem89 UTSW 9 108915417 missense probably damaging 1.00
R0063:Tmem89 UTSW 9 108914812 missense probably benign 0.00
R0063:Tmem89 UTSW 9 108914812 missense probably benign 0.00
R2447:Tmem89 UTSW 9 108914800 missense probably damaging 0.98
R4778:Tmem89 UTSW 9 108915375 missense probably damaging 0.98
R4906:Tmem89 UTSW 9 108914761 unclassified probably benign
R5529:Tmem89 UTSW 9 108915477 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CGATGGCGAGCTAAGGTTGCTAAG -3'
(R):5'- GAAGCATATATTGGGTCACCCAGACTG -3'

Sequencing Primer
(F):5'- TGGAGACCCAGTGACCTATTC -3'
(R):5'- CCAGACTGAGGGGGGGAC -3'
Posted On2014-06-06