Incidental Mutation 'R0060:Nubpl'
ID201411
Institutional Source Beutler Lab
Gene Symbol Nubpl
Ensembl Gene ENSMUSG00000035142
Gene Namenucleotide binding protein-like
Synonyms2410170E07Rik
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.634) question?
Stock #R0060 (G1)
Quality Score24
Status Validated
Chromosome12
Chromosomal Location52097737-52312744 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 52310687 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000044292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040090]
Predicted Effect probably benign
Transcript: ENSMUST00000040090
SMART Domains Protein: ENSMUSP00000044292
Gene: ENSMUSG00000035142

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ParA 65 311 1.6e-101 PFAM
Pfam:AAA_31 68 131 2.6e-9 PFAM
Pfam:MipZ 68 217 2.8e-9 PFAM
Pfam:CbiA 70 241 9.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Mrp/NBP35 ATP-binding proteins family. The encoded protein is required for the assembly of the respiratory chain NADH dehydrogenase (complex I), an oligomeric enzymatic complex located in the inner mitochondrial membrane. Mutations in this gene cause mitochondrial complex I deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Nubpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Nubpl APN 12 52305855 missense probably damaging 0.96
IGL01415:Nubpl APN 12 52271070 missense possibly damaging 0.91
IGL02538:Nubpl APN 12 52310694 splice site probably benign
IGL02644:Nubpl APN 12 52271058 missense probably damaging 0.99
R0060:Nubpl UTSW 12 52310687 splice site probably benign
R3851:Nubpl UTSW 12 52144027 missense probably damaging 1.00
R4939:Nubpl UTSW 12 52181095 missense probably damaging 0.98
R5553:Nubpl UTSW 12 52181299 missense possibly damaging 0.90
R5691:Nubpl UTSW 12 52105276 intron probably benign
R5886:Nubpl UTSW 12 52181309 critical splice donor site probably null
R6654:Nubpl UTSW 12 52310733 missense probably damaging 1.00
R6899:Nubpl UTSW 12 52310753 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTCGCCTTCTAAGCACTTACCC -3'
(R):5'- GGACGATAGCATCACGAAGTCACAG -3'

Sequencing Primer
(F):5'- AGCACTTACCCTTAAATAGTGAGAG -3'
(R):5'- CGAAGTCACAGTTTCTCAAGAG -3'
Posted On2014-06-06