Incidental Mutation 'R0060:Sema4d'
ID201412
Institutional Source Beutler Lab
Gene Symbol Sema4d
Ensembl Gene ENSMUSG00000021451
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D
SynonymsSemacl2, coll-4, Semcl2, semaphorin H, CD100, Semaj, M-sema G
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0060 (G1)
Quality Score73
Status Validated
Chromosome13
Chromosomal Location51685529-51793747 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 51705257 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021900] [ENSMUST00000110039] [ENSMUST00000110040] [ENSMUST00000110042]
Predicted Effect probably benign
Transcript: ENSMUST00000021900
SMART Domains Protein: ENSMUSP00000021900
Gene: ENSMUSG00000021451

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 482 7.68e-192 SMART
PSI 502 554 1.41e-12 SMART
IG 561 647 4.78e-1 SMART
transmembrane domain 733 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110039
SMART Domains Protein: ENSMUSP00000105666
Gene: ENSMUSG00000021451

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 482 7.68e-192 SMART
PSI 502 554 1.41e-12 SMART
IG 561 647 4.78e-1 SMART
transmembrane domain 733 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110040
SMART Domains Protein: ENSMUSP00000105667
Gene: ENSMUSG00000021451

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 482 7.68e-192 SMART
PSI 502 554 1.41e-12 SMART
IG 561 647 4.78e-1 SMART
transmembrane domain 733 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110042
SMART Domains Protein: ENSMUSP00000105669
Gene: ENSMUSG00000021451

DomainStartEndE-ValueType
Blast:IG 2 46 2e-15 BLAST
Meta Mutation Damage Score 0.1412 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display functional defects in their immune system but are normal in other systems of the body. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Sema4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Sema4d APN 13 51702937 intron probably null
IGL02155:Sema4d APN 13 51703267 missense probably benign 0.01
IGL02422:Sema4d APN 13 51703088 missense probably benign
IGL02795:Sema4d APN 13 51703411 missense probably benign 0.00
IGL03068:Sema4d APN 13 51708886 missense probably damaging 1.00
IGL03164:Sema4d APN 13 51708922 missense possibly damaging 0.58
R0060:Sema4d UTSW 13 51705257 unclassified probably benign
R0305:Sema4d UTSW 13 51712728 missense probably damaging 1.00
R0309:Sema4d UTSW 13 51725311 missense probably benign 0.14
R0708:Sema4d UTSW 13 51712719 missense probably benign 0.17
R1809:Sema4d UTSW 13 51713691 critical splice donor site probably null
R1851:Sema4d UTSW 13 51711222 missense possibly damaging 0.94
R2096:Sema4d UTSW 13 51710001 missense probably damaging 1.00
R2159:Sema4d UTSW 13 51720535 missense probably damaging 1.00
R2367:Sema4d UTSW 13 51703140 intron probably benign
R4329:Sema4d UTSW 13 51703304 missense probably benign
R4372:Sema4d UTSW 13 51712731 missense probably damaging 1.00
R4384:Sema4d UTSW 13 51702883 missense probably damaging 1.00
R4590:Sema4d UTSW 13 51723618 missense probably benign 0.29
R4980:Sema4d UTSW 13 51711234 missense probably damaging 1.00
R5523:Sema4d UTSW 13 51711354 missense possibly damaging 0.89
R6086:Sema4d UTSW 13 51713745 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGAAGACAGCAGGCGCACA -3'
(R):5'- AGGTCTTAGCGGTCGGGCCTT -3'

Sequencing Primer
(F):5'- AGGCGCACATTACTCTATGGC -3'
(R):5'- GCCTTGTGGCCTATTCTGAG -3'
Posted On2014-06-06