Incidental Mutation 'R0060:Colec10'
ID201414
Institutional Source Beutler Lab
Gene Symbol Colec10
Ensembl Gene ENSMUSG00000038591
Gene Namecollectin sub-family member 10
SynonymsCL-L1
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R0060 (G1)
Quality Score20
Status Validated
Chromosome15
Chromosomal Location54410774-54466358 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 54439146 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036737]
Predicted Effect probably benign
Transcript: ENSMUST00000036737
SMART Domains Protein: ENSMUSP00000037867
Gene: ENSMUSG00000038591

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Collagen 44 96 1.4e-9 PFAM
Pfam:Collagen 65 123 4.3e-10 PFAM
CLECT 148 271 1.09e-16 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the C-lectin family, proteins that possess collagen-like sequences and carbohydrate recognition domains. The other members of this family are secreted proteins and bind to carbohydrate antigens on microorganisms facilitating their recognition and removal. This gene product is a cytosolic protein, a characteristic that suggests that it may have different biological functions than other C-lectins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tcerg1 C T 18: 42,524,008 A185V unknown Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Colec10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Colec10 APN 15 54459761 missense probably damaging 0.98
R0004:Colec10 UTSW 15 54410875 missense possibly damaging 0.57
R0060:Colec10 UTSW 15 54439146 splice site probably benign
R0827:Colec10 UTSW 15 54462584 missense probably damaging 1.00
R1238:Colec10 UTSW 15 54462439 missense possibly damaging 0.75
R1551:Colec10 UTSW 15 54462262 missense probably damaging 1.00
R2371:Colec10 UTSW 15 54462400 missense possibly damaging 0.84
R4023:Colec10 UTSW 15 54462551 missense probably damaging 1.00
R4024:Colec10 UTSW 15 54462551 missense probably damaging 1.00
R4628:Colec10 UTSW 15 54459731 missense possibly damaging 0.68
R5893:Colec10 UTSW 15 54410789 missense probably benign 0.18
R6062:Colec10 UTSW 15 54459807 missense possibly damaging 0.93
R6489:Colec10 UTSW 15 54462213 splice site probably null
R6775:Colec10 UTSW 15 54435023 missense possibly damaging 0.95
R6928:Colec10 UTSW 15 54462606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCAAACCATCACAACTTGTCATCT -3'
(R):5'- TCCAGGGAGAGAGTTCAACATAGAACC -3'

Sequencing Primer
(F):5'- CACAACTTGTCATCTtaggtagaag -3'
(R):5'- TTGCATAAGACTCAAGTTCAGGAG -3'
Posted On2014-06-06