Incidental Mutation 'R0060:Tcerg1'
ID201417
Institutional Source Beutler Lab
Gene Symbol Tcerg1
Ensembl Gene ENSMUSG00000024498
Gene Nametranscription elongation regulator 1 (CA150)
SynonymsTaf2s, 2410022J09Rik, 2900090C16Rik, Fbp28, p144, ca150
MMRRC Submission 038353-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.875) question?
Stock #R0060 (G1)
Quality Score43
Status Validated
Chromosome18
Chromosomal Location42511510-42575551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 42524008 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 185 (A185V)
Ref Sequence ENSEMBL: ENSMUSP00000134458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025375] [ENSMUST00000173642]
Predicted Effect unknown
Transcript: ENSMUST00000025375
AA Change: A185V
SMART Domains Protein: ENSMUSP00000025375
Gene: ENSMUSG00000024498
AA Change: A185V

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
FF 1014 1079 1.3e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000173642
AA Change: A185V
SMART Domains Protein: ENSMUSP00000134458
Gene: ENSMUSG00000024498
AA Change: A185V

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.0%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that regulates transcriptional elongation and pre-mRNA splicing. The encoded protein interacts with the hyperphosphorylated C-terminal domain of RNA polymerase II via multiple FF domains, and with the pre-mRNA splicing factor SF1 via a WW domain. Alternative splicing results in multiple transcripts variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810065E05Rik A C 11: 58,422,182 probably benign Het
A630091E08Rik A G 7: 98,543,668 noncoding transcript Het
Abca8a T C 11: 110,070,480 T539A probably damaging Het
Ankrd60 A T 2: 173,572,613 M1K probably null Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Cabcoco1 A T 10: 68,533,862 probably null Het
Capn7 T C 14: 31,365,604 probably benign Het
Cd109 G A 9: 78,703,107 E1145K probably damaging Het
Celsr1 A T 15: 85,922,198 V2353D probably damaging Het
Cep350 C T 1: 155,928,626 D904N probably damaging Het
Chl1 T A 6: 103,711,058 probably benign Het
Colec10 G A 15: 54,439,146 probably benign Het
Cst11 T A 2: 148,770,402 Q105L probably damaging Het
Eps8l3 T C 3: 107,879,541 L11S probably damaging Het
Gsdme A G 6: 50,221,029 I317T possibly damaging Het
Itgad T C 7: 128,202,986 S979P probably damaging Het
Mga T C 2: 119,960,961 probably null Het
Nubpl T C 12: 52,310,687 probably benign Het
Olfr1105 T C 2: 87,033,774 Y149C probably damaging Het
Olfr124 T C 17: 37,806,000 L285P probably damaging Het
Pard3b G A 1: 61,639,315 E25K probably damaging Het
Phactr1 T A 13: 42,682,721 Y8* probably null Het
Phf14 T C 6: 11,953,317 S352P probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prap1 G T 7: 140,093,477 probably benign Het
Prdm8 T A 5: 98,185,260 F229I probably benign Het
Rfx6 T C 10: 51,677,840 F11L probably benign Het
Rfx8 T A 1: 39,718,405 probably benign Het
Rif1 C T 2: 52,111,117 R1528C probably damaging Het
Ripk4 G A 16: 97,763,518 probably benign Het
Satb1 T A 17: 51,740,203 I695F probably damaging Het
Sema4d A G 13: 51,705,257 probably benign Het
Slc30a4 T A 2: 122,685,184 T381S probably benign Het
Suv39h2 T C 2: 3,464,916 Y134C probably damaging Het
Tep1 T A 14: 50,866,029 D268V probably damaging Het
Tmem89 T A 9: 108,915,417 V126D probably damaging Het
Trf T C 9: 103,220,922 T46A probably benign Het
Trmt6 C T 2: 132,806,769 R415Q possibly damaging Het
Trp53bp1 T C 2: 121,204,525 K1625E probably damaging Het
Zcchc4 T A 5: 52,807,078 I292N possibly damaging Het
Other mutations in Tcerg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00701:Tcerg1 APN 18 42536342 missense probably benign 0.34
IGL00708:Tcerg1 APN 18 42571125 missense probably benign 0.38
IGL00741:Tcerg1 APN 18 42568453 missense possibly damaging 0.94
IGL01314:Tcerg1 APN 18 42573309 missense probably damaging 1.00
IGL01358:Tcerg1 APN 18 42524277 missense unknown
IGL01832:Tcerg1 APN 18 42574555 missense probably damaging 0.99
IGL01985:Tcerg1 APN 18 42530656 missense unknown
IGL02937:Tcerg1 APN 18 42524349 missense unknown
IGL02953:Tcerg1 APN 18 42548470 missense probably damaging 1.00
IGL03082:Tcerg1 APN 18 42573357 missense probably damaging 1.00
tarantula UTSW 18 42536348 missense probably damaging 0.98
P0031:Tcerg1 UTSW 18 42573302 missense probably benign 0.07
R0138:Tcerg1 UTSW 18 42568614 splice site probably benign
R0482:Tcerg1 UTSW 18 42564240 splice site probably benign
R0502:Tcerg1 UTSW 18 42522956 missense unknown
R0731:Tcerg1 UTSW 18 42571840 missense probably damaging 0.99
R1117:Tcerg1 UTSW 18 42574652 missense probably damaging 0.99
R1542:Tcerg1 UTSW 18 42553430 missense probably damaging 0.99
R1571:Tcerg1 UTSW 18 42524292 missense unknown
R1673:Tcerg1 UTSW 18 42552581 missense possibly damaging 0.91
R1678:Tcerg1 UTSW 18 42524349 missense unknown
R1799:Tcerg1 UTSW 18 42560947 missense possibly damaging 0.92
R2094:Tcerg1 UTSW 18 42564145 missense possibly damaging 0.92
R2231:Tcerg1 UTSW 18 42524244 missense unknown
R2989:Tcerg1 UTSW 18 42519475 missense unknown
R3831:Tcerg1 UTSW 18 42568489 missense probably damaging 1.00
R4009:Tcerg1 UTSW 18 42564136 frame shift probably null
R4034:Tcerg1 UTSW 18 42519533 missense unknown
R4826:Tcerg1 UTSW 18 42535115 missense unknown
R4858:Tcerg1 UTSW 18 42523981 missense unknown
R5371:Tcerg1 UTSW 18 42519535 missense unknown
R5865:Tcerg1 UTSW 18 42536348 missense probably damaging 0.98
R6128:Tcerg1 UTSW 18 42511498 unclassified probably null
R6258:Tcerg1 UTSW 18 42553465 missense probably damaging 1.00
R6260:Tcerg1 UTSW 18 42553465 missense probably damaging 1.00
R6516:Tcerg1 UTSW 18 42530892 critical splice donor site probably null
R6825:Tcerg1 UTSW 18 42548477 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTGAAGCTCTGGTGGCTTGAGAT -3'
(R):5'- GCTTGTGCTTGGACTTGTgcct -3'

Sequencing Primer
(F):5'- tctaacttggaagagagtggtg -3'
(R):5'- GCTTGGGCTTGAGCCTGA -3'
Posted On2014-06-06