Incidental Mutation 'R0082:4833427G06Rik'
ID201430
Institutional Source Beutler Lab
Gene Symbol 4833427G06Rik
Ensembl Gene ENSMUSG00000032057
Gene NameRIKEN cDNA 4833427G06 gene
Synonyms
MMRRC Submission 038369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R0082 (G1)
Quality Score41
Status Validated
Chromosome9
Chromosomal Location51081115-51102078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51101802 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 57 (T57A)
Ref Sequence ENSEMBL: ENSMUSP00000126725 (fasta)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083558
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083653
Predicted Effect probably benign
Transcript: ENSMUST00000170947
AA Change: T57A

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000213680
Predicted Effect probably benign
Transcript: ENSMUST00000214452
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.3%
  • 10x: 91.7%
  • 20x: 73.7%
Validation Efficiency 94% (136/144)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam17 A C 12: 21,329,048 probably benign Het
Adcy1 T C 11: 7,149,497 probably benign Het
Ahrr G A 13: 74,283,024 probably benign Het
Ankrd33b T C 15: 31,297,789 N274S probably benign Het
Arhgef1 C T 7: 24,912,605 Q100* probably null Het
BC030499 T C 11: 78,293,558 S244P probably damaging Het
Ccdc180 A G 4: 45,896,205 D118G probably null Het
Cdh23 T C 10: 60,312,587 D2667G probably damaging Het
Cdh4 A T 2: 179,894,188 N844I possibly damaging Het
Cep57 T C 9: 13,810,876 probably benign Het
Dnah7a A T 1: 53,518,708 D2182E probably damaging Het
Dync1h1 A G 12: 110,636,446 T2174A probably benign Het
Eef1akmt2 T A 7: 132,851,472 R44* probably null Het
Evpl T A 11: 116,235,003 I43F probably damaging Het
F13a1 G T 13: 36,988,953 P151Q probably damaging Het
Fam173a T C 17: 25,791,574 I89V probably benign Het
Galnt5 A T 2: 57,999,035 I216F possibly damaging Het
Glt6d1 C A 2: 25,794,727 probably null Het
Gpr139 T A 7: 119,145,045 T106S probably benign Het
Hoxb3 A G 11: 96,344,271 D8G probably damaging Het
Hpse T C 5: 100,692,262 K330E possibly damaging Het
Kcmf1 G T 6: 72,850,487 probably null Het
Klra2 T C 6: 131,220,247 N263S possibly damaging Het
Klra8 T C 6: 130,125,055 D139G probably benign Het
Lrrc46 A C 11: 97,041,077 probably benign Het
Ly86 A T 13: 37,418,537 probably null Het
Mmp20 C T 9: 7,642,807 T214M probably benign Het
Olfr591 G T 7: 103,173,202 A145E probably benign Het
Olfr729 A T 14: 50,148,055 I273K probably damaging Het
Olfr786 T C 10: 129,437,271 I153T possibly damaging Het
Olfr799 G A 10: 129,647,653 C175Y probably benign Het
Pigg A G 5: 108,312,885 probably benign Het
Polq C A 16: 37,017,257 T177K probably benign Het
Pomgnt2 A T 9: 121,982,260 V485E probably damaging Het
Ppip5k2 A T 1: 97,759,332 C49* probably null Het
Prkrip1 T C 5: 136,197,828 N53D possibly damaging Het
Prrc2b T C 2: 32,212,298 probably benign Het
Qprt T C 7: 127,108,186 E246G probably damaging Het
Rpl9 A G 5: 65,388,652 V167A probably benign Het
Sfi1 TCGC TC 11: 3,146,254 probably null Het
Sgsm1 T C 5: 113,288,836 I43V probably benign Het
Slc38a7 A G 8: 95,840,481 probably benign Het
Slc8b1 A G 5: 120,524,200 probably benign Het
Sp2 T C 11: 96,961,699 Y133C probably damaging Het
Spdye4b A T 5: 143,195,675 D95V probably damaging Het
Srek1 T C 13: 103,743,686 T455A unknown Het
Stox2 A T 8: 47,203,282 probably benign Het
Synrg T A 11: 83,987,910 probably benign Het
Tie1 T A 4: 118,484,353 E254V probably damaging Het
Tmem97 G T 11: 78,542,588 F160L probably damaging Het
Utp6 A T 11: 79,953,631 H189Q possibly damaging Het
Vip T A 10: 5,644,953 *172R probably null Het
Wdr91 T C 6: 34,906,685 R132G possibly damaging Het
Wipi1 T C 11: 109,578,284 probably benign Het
Zfp445 A G 9: 122,852,356 V840A probably damaging Het
Other mutations in 4833427G06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:4833427G06Rik APN 9 51083586 nonsense probably null
IGL01475:4833427G06Rik APN 9 51100058 missense probably benign 0.28
IGL02137:4833427G06Rik APN 9 51086108 intron probably benign
R0080:4833427G06Rik UTSW 9 51101802 missense probably benign 0.32
R0631:4833427G06Rik UTSW 9 51101953 missense probably benign 0.00
R1655:4833427G06Rik UTSW 9 51083621 missense probably damaging 0.98
R2116:4833427G06Rik UTSW 9 51101084 missense possibly damaging 0.74
R2444:4833427G06Rik UTSW 9 51099998 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGATCCTTTACAGTGGAGAATTGCAGC -3'
(R):5'- CTAAGGAAAGCGTCCTGAGTCACC -3'

Sequencing Primer
(F):5'- TAGACCAGGCAGTTTCCCCTT -3'
(R):5'- CCCTGGATTACTGGTGTTCA -3'
Posted On2014-06-10