Incidental Mutation 'R0041:Wdr64'
ID201482
Institutional Source Beutler Lab
Gene Symbol Wdr64
Ensembl Gene ENSMUSG00000026523
Gene NameWD repeat domain 64
Synonyms4930511H01Rik, 4930415O10Rik
MMRRC Submission 038335-MU
Accession Numbers

Ncbi RefSeq: NM_029453.2; MGI:1923070

Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R0041 (G1)
Quality Score68
Status Validated
Chromosome1
Chromosomal Location175698593-175815734 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 175726471 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 189 (W189*)
Ref Sequence ENSEMBL: ENSMUSP00000141740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094288] [ENSMUST00000171939] [ENSMUST00000194087]
Predicted Effect probably null
Transcript: ENSMUST00000094288
AA Change: W199*
SMART Domains Protein: ENSMUSP00000091846
Gene: ENSMUSG00000026523
AA Change: W199*

DomainStartEndE-ValueType
WD40 118 159 2.65e1 SMART
WD40 162 200 2.13e1 SMART
low complexity region 259 271 N/A INTRINSIC
Blast:WD40 277 316 5e-19 BLAST
WD40 323 361 2.4e-1 SMART
WD40 365 404 8.29e-1 SMART
WD40 407 449 1.7e2 SMART
WD40 457 493 1.19e1 SMART
WD40 497 538 4.55e-3 SMART
WD40 643 684 3.31e0 SMART
WD40 742 806 7.4e0 SMART
Blast:WD40 811 851 7e-17 BLAST
WD40 864 903 4.62e-4 SMART
Blast:XPGN 921 964 9e-19 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000171939
AA Change: W189*
SMART Domains Protein: ENSMUSP00000128678
Gene: ENSMUSG00000026523
AA Change: W189*

DomainStartEndE-ValueType
WD40 151 190 5.73e0 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 306 4e-19 BLAST
WD40 313 351 2.4e-1 SMART
WD40 355 394 8.29e-1 SMART
WD40 397 439 1.7e2 SMART
WD40 447 483 1.19e1 SMART
WD40 487 528 4.55e-3 SMART
WD40 633 674 3.31e0 SMART
WD40 732 796 7.4e0 SMART
Blast:WD40 801 841 5e-17 BLAST
WD40 854 893 4.62e-4 SMART
Blast:XPGN 911 954 1e-18 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000194087
AA Change: W189*
SMART Domains Protein: ENSMUSP00000141740
Gene: ENSMUSG00000026523
AA Change: W189*

DomainStartEndE-ValueType
WD40 151 190 3.6e-2 SMART
low complexity region 249 261 N/A INTRINSIC
Blast:WD40 267 305 5e-19 BLAST
WD40 313 351 1.5e-3 SMART
WD40 355 394 5.2e-3 SMART
WD40 397 439 1.1e0 SMART
WD40 447 483 7.6e-2 SMART
WD40 487 528 2.9e-5 SMART
WD40 633 674 2.1e-2 SMART
WD40 732 796 4.7e-2 SMART
Blast:WD40 801 841 6e-17 BLAST
WD40 854 893 2.9e-6 SMART
Blast:XPGN 911 954 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195794
Meta Mutation Damage Score 0.566 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Other mutations in Wdr64
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Wdr64 APN 1 175698800 missense probably benign 0.00
IGL00902:Wdr64 APN 1 175728825 missense probably damaging 1.00
IGL01347:Wdr64 APN 1 175720333 missense probably benign 0.12
IGL01353:Wdr64 APN 1 175731585 missense probably damaging 0.96
IGL01583:Wdr64 APN 1 175767156 critical splice donor site probably null
IGL01643:Wdr64 APN 1 175772311 missense probably damaging 1.00
IGL01673:Wdr64 APN 1 175800356 missense possibly damaging 0.68
IGL01992:Wdr64 APN 1 175706071 missense probably damaging 1.00
IGL02613:Wdr64 APN 1 175767047 nonsense probably null
IGL02834:Wdr64 APN 1 175805849 splice site probably benign
IGL03214:Wdr64 APN 1 175743635 splice site probably benign
IGL03305:Wdr64 APN 1 175755586 missense possibly damaging 0.94
IGL03308:Wdr64 APN 1 175766996 unclassified probably benign
R0036:Wdr64 UTSW 1 175728930 nonsense probably null
R0041:Wdr64 UTSW 1 175726471 nonsense probably null
R0079:Wdr64 UTSW 1 175795102 missense probably benign 0.02
R0380:Wdr64 UTSW 1 175769642 splice site probably benign
R0486:Wdr64 UTSW 1 175795203 splice site probably benign
R0520:Wdr64 UTSW 1 175726392 missense probably damaging 1.00
R0598:Wdr64 UTSW 1 175805899 missense probably damaging 1.00
R0711:Wdr64 UTSW 1 175772185 missense probably benign 0.39
R0746:Wdr64 UTSW 1 175792973 missense possibly damaging 0.92
R0927:Wdr64 UTSW 1 175793081 missense probably damaging 0.97
R0947:Wdr64 UTSW 1 175775749 missense probably benign
R1014:Wdr64 UTSW 1 175755626 missense probably damaging 1.00
R1332:Wdr64 UTSW 1 175795140 missense possibly damaging 0.82
R1416:Wdr64 UTSW 1 175806002 missense probably benign 0.01
R1421:Wdr64 UTSW 1 175767150 missense possibly damaging 0.85
R1467:Wdr64 UTSW 1 175775722 missense probably benign 0.00
R1467:Wdr64 UTSW 1 175775722 missense probably benign 0.00
R1796:Wdr64 UTSW 1 175717331 missense probably damaging 1.00
R1797:Wdr64 UTSW 1 175812019 missense probably damaging 1.00
R2145:Wdr64 UTSW 1 175767095 missense probably benign 0.01
R2321:Wdr64 UTSW 1 175795087 missense possibly damaging 0.57
R2449:Wdr64 UTSW 1 175698913 missense probably benign
R4049:Wdr64 UTSW 1 175805856 missense probably benign 0.21
R4155:Wdr64 UTSW 1 175769606 missense probably benign 0.03
R4624:Wdr64 UTSW 1 175772263 missense probably benign
R4661:Wdr64 UTSW 1 175726494 missense probably damaging 1.00
R4711:Wdr64 UTSW 1 175799229 missense probably damaging 1.00
R4891:Wdr64 UTSW 1 175698779 unclassified probably benign
R4925:Wdr64 UTSW 1 175724702 splice site probably null
R4943:Wdr64 UTSW 1 175720316 missense probably benign 0.01
R5000:Wdr64 UTSW 1 175726375 splice site probably null
R5001:Wdr64 UTSW 1 175792959 critical splice acceptor site probably null
R5143:Wdr64 UTSW 1 175726413 missense probably damaging 1.00
R5395:Wdr64 UTSW 1 175755598 missense probably damaging 1.00
R5813:Wdr64 UTSW 1 175812057 missense possibly damaging 0.89
R6014:Wdr64 UTSW 1 175805990 missense possibly damaging 0.56
R6417:Wdr64 UTSW 1 175726390 missense probably damaging 1.00
R6456:Wdr64 UTSW 1 175785609 critical splice donor site probably null
R6555:Wdr64 UTSW 1 175720290 missense probably damaging 1.00
R6576:Wdr64 UTSW 1 175805928 missense possibly damaging 0.82
R6797:Wdr64 UTSW 1 175810610 critical splice donor site probably null
R6891:Wdr64 UTSW 1 175706068 missense probably damaging 1.00
R6959:Wdr64 UTSW 1 175705989 missense probably damaging 1.00
Z1088:Wdr64 UTSW 1 175705985 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AAGCTTTGCTGCCAGATGGGAC -3'
(R):5'- AGACTGTGCCGTGTGAAAAGACC -3'

Sequencing Primer
(F):5'- CTGgtgatactggagactacac -3'
(R):5'- GTGTGAAAAGACCTCCTGCC -3'
Posted On2014-06-13