Incidental Mutation 'R0041:Trpm4'
ID201488
Institutional Source Beutler Lab
Gene Symbol Trpm4
Ensembl Gene ENSMUSG00000038260
Gene Nametransient receptor potential cation channel, subfamily M, member 4
SynonymsLTRPC4, TRPM4B, 1110030C19Rik
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R0041 (G1)
Quality Score69
Status Validated
Chromosome7
Chromosomal Location45302632-45333780 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 45304946 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042194] [ENSMUST00000209506] [ENSMUST00000210311] [ENSMUST00000211431] [ENSMUST00000211743]
Predicted Effect probably null
Transcript: ENSMUST00000042194
SMART Domains Protein: ENSMUSP00000040367
Gene: ENSMUSG00000038260

DomainStartEndE-ValueType
low complexity region 118 131 N/A INTRINSIC
SCOP:d1awcb_ 378 465 2e-3 SMART
low complexity region 600 612 N/A INTRINSIC
low complexity region 637 645 N/A INTRINSIC
transmembrane domain 688 710 N/A INTRINSIC
Pfam:Ion_trans 781 1051 1.8e-13 PFAM
low complexity region 1089 1096 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209239
Predicted Effect probably benign
Transcript: ENSMUST00000209506
Predicted Effect probably null
Transcript: ENSMUST00000210311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210639
Predicted Effect probably benign
Transcript: ENSMUST00000211431
Predicted Effect probably null
Transcript: ENSMUST00000211743
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a calcium-activated nonselective ion channel that mediates transport of monovalent cations across membranes, thereby depolarizing the membrane. The activity of the encoded protein increases with increasing intracellular calcium concentration, but this channel does not transport calcium. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display increased Ca2+ influx and IgE-dependent mast cell activation, increased vascular permeability, and enhanced acute anaphylactic responses. Mice homozygous for a different knock-out allele show Ca2+ overload and impaired dendritic cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Trpm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Trpm4 APN 7 45318349 missense probably benign
IGL01327:Trpm4 APN 7 45315073 missense probably damaging 1.00
IGL02069:Trpm4 APN 7 45319294 missense probably damaging 1.00
IGL02124:Trpm4 APN 7 45310523 missense probably damaging 1.00
IGL02141:Trpm4 APN 7 45318179 splice site probably null
IGL02333:Trpm4 APN 7 45322115 missense possibly damaging 0.85
IGL02338:Trpm4 APN 7 45326998 missense probably damaging 1.00
IGL02741:Trpm4 APN 7 45318488 missense possibly damaging 0.82
R0106:Trpm4 UTSW 7 45319240 critical splice donor site probably null
R0270:Trpm4 UTSW 7 45319253 missense possibly damaging 0.45
R0279:Trpm4 UTSW 7 45322048 missense probably damaging 0.99
R0309:Trpm4 UTSW 7 45308706 missense probably damaging 1.00
R0539:Trpm4 UTSW 7 45305472 missense probably damaging 0.99
R0969:Trpm4 UTSW 7 45327907 intron probably benign
R1454:Trpm4 UTSW 7 45317056 missense probably damaging 0.99
R1512:Trpm4 UTSW 7 45315044 missense probably benign 0.07
R1579:Trpm4 UTSW 7 45308597 missense probably damaging 1.00
R1768:Trpm4 UTSW 7 45308612 missense probably damaging 0.97
R2847:Trpm4 UTSW 7 45310598 missense probably damaging 1.00
R3883:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R3884:Trpm4 UTSW 7 45321998 critical splice donor site probably null
R4895:Trpm4 UTSW 7 45318058 missense probably damaging 0.98
R5056:Trpm4 UTSW 7 45308630 missense probably damaging 0.98
R5060:Trpm4 UTSW 7 45321834 missense probably damaging 1.00
R5069:Trpm4 UTSW 7 45310469 missense probably damaging 1.00
R5560:Trpm4 UTSW 7 45310332 missense probably damaging 1.00
R5783:Trpm4 UTSW 7 45310389 missense probably benign
R5874:Trpm4 UTSW 7 45327749 missense probably damaging 1.00
R6176:Trpm4 UTSW 7 45326676 missense probably damaging 1.00
R6302:Trpm4 UTSW 7 45327719 critical splice donor site probably null
R6431:Trpm4 UTSW 7 45326568 missense possibly damaging 0.79
R6762:Trpm4 UTSW 7 45304816 utr 3 prime probably benign
R6827:Trpm4 UTSW 7 45318628 missense possibly damaging 0.89
R6845:Trpm4 UTSW 7 45322329 missense possibly damaging 0.88
R6950:Trpm4 UTSW 7 45319280 missense probably damaging 0.97
X0018:Trpm4 UTSW 7 45314634 missense possibly damaging 0.61
X0022:Trpm4 UTSW 7 45310511 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACCACACTGACCTTTGGAACC -3'
(R):5'- TCTTCGAGCACTTCCGTGAGACTG -3'

Sequencing Primer
(F):5'- ACTGACCTTTGGAACCAGTGG -3'
(R):5'- ACAAGTTCCCAAGTGGTCCTG -3'
Posted On2014-06-13