Incidental Mutation 'R0041:Peg12'
ID201489
Institutional Source Beutler Lab
Gene Symbol Peg12
Ensembl Gene ENSMUSG00000070526
Gene Namepaternally expressed 12
SynonymsFrat3
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0041 (G1)
Quality Score69
Status Validated
Chromosome7
Chromosomal Location62461871-62464510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 62463560 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 263 (E263V)
Ref Sequence ENSEMBL: ENSMUSP00000091897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094339]
Predicted Effect unknown
Transcript: ENSMUST00000094339
AA Change: E263V
SMART Domains Protein: ENSMUSP00000091897
Gene: ENSMUSG00000070526
AA Change: E263V

DomainStartEndE-ValueType
Pfam:GSK-3_bind 1 232 4.5e-120 PFAM
Meta Mutation Damage Score 0.0728 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Homozygous mice are healthy and fertile with no obvious abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Peg12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0189:Peg12 UTSW 7 62463548 missense unknown
R1450:Peg12 UTSW 7 62463576 nonsense probably null
R1867:Peg12 UTSW 7 62463668 missense probably benign 0.43
R1868:Peg12 UTSW 7 62463668 missense probably benign 0.43
R2018:Peg12 UTSW 7 62463638 missense probably benign 0.33
R4255:Peg12 UTSW 7 62463731 missense possibly damaging 0.93
R6714:Peg12 UTSW 7 62463569 missense unknown
R7054:Peg12 UTSW 7 62463963 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- ACAGCAAGTAACGGGGATCATTGTC -3'
(R):5'- AGCAGCTCCTTCTTTCGGGAAAC -3'

Sequencing Primer
(F):5'- aaaaaaaaaaaaaagaaGTCCTGCTG -3'
(R):5'- TCTTTCGGGAAACCTCATCAAGG -3'
Posted On2014-06-13