Incidental Mutation 'R0041:Swap70'
ID201490
Institutional Source Beutler Lab
Gene Symbol Swap70
Ensembl Gene ENSMUSG00000031015
Gene NameSWA-70 protein
Synonyms70kDa
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R0041 (G1)
Quality Score34
Status Validated
Chromosome7
Chromosomal Location110221711-110283506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110279355 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 511 (K511E)
Ref Sequence ENSEMBL: ENSMUSP00000033325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033325]
Predicted Effect probably benign
Transcript: ENSMUST00000033325
AA Change: K511E

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000033325
Gene: ENSMUSG00000031015
AA Change: K511E

DomainStartEndE-ValueType
PH 211 308 7.23e-20 SMART
coiled coil region 316 529 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210796
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in increased sensitivity of B lymphocytes to gamma-radiation, increased autoantibody levels, and lower IgE levels, both before and after immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Swap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01888:Swap70 APN 7 110280634 missense probably damaging 1.00
IGL02307:Swap70 APN 7 110281294 missense probably benign 0.05
IGL02429:Swap70 APN 7 110263972 missense probably benign
IGL02741:Swap70 APN 7 110274649 missense probably benign 0.01
galloping UTSW 7 110269919 missense probably benign
R0037:Swap70 UTSW 7 110264080 missense possibly damaging 0.77
R0041:Swap70 UTSW 7 110279355 missense probably benign 0.04
R0116:Swap70 UTSW 7 110273282 missense probably benign 0.25
R1615:Swap70 UTSW 7 110273291 missense probably benign 0.01
R1623:Swap70 UTSW 7 110264048 missense probably benign 0.00
R1656:Swap70 UTSW 7 110221827 missense probably benign 0.02
R1932:Swap70 UTSW 7 110279263 missense possibly damaging 0.70
R3720:Swap70 UTSW 7 110270047 missense probably damaging 0.98
R3753:Swap70 UTSW 7 110267881 missense probably damaging 1.00
R4012:Swap70 UTSW 7 110281305 missense possibly damaging 0.92
R4623:Swap70 UTSW 7 110267872 missense probably benign 0.42
R6158:Swap70 UTSW 7 110270023 missense probably damaging 1.00
R6180:Swap70 UTSW 7 110269981 missense probably damaging 1.00
R6521:Swap70 UTSW 7 110255820 missense probably benign 0.00
R6692:Swap70 UTSW 7 110269919 missense probably benign
R6823:Swap70 UTSW 7 110281303 missense possibly damaging 0.75
R6846:Swap70 UTSW 7 110255749 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGAGAAAACACACTTGACGCTGTTC -3'
(R):5'- TCTCTTTGCTAAGCAAGATTCCGCC -3'

Sequencing Primer
(F):5'- AGATGCTCGTCTCTGAAATGC -3'
(R):5'- AGATTCCGCCAAGTGAGTGC -3'
Posted On2014-06-13