Incidental Mutation 'R0041:Galnt4'
ID201495
Institutional Source Beutler Lab
Gene Symbol Galnt4
Ensembl Gene ENSMUSG00000090035
Gene Namepolypeptide N-acetylgalactosaminyltransferase 4
SynonymsppGaNTase-T4
MMRRC Submission 038335-MU
Accession Numbers

Genbank: NM_015737; MGI: 894692

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0041 (G1)
Quality Score53
Status Validated
Chromosome10
Chromosomal Location99108159-99113247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99108512 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 33 (Y33C)
Ref Sequence ENSEMBL: ENSMUSP00000125315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020113] [ENSMUST00000159228] [ENSMUST00000159990] [ENSMUST00000161240] [ENSMUST00000219884]
Predicted Effect probably benign
Transcript: ENSMUST00000020113
SMART Domains Protein: ENSMUSP00000020113
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 428 468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159228
SMART Domains Protein: ENSMUSP00000124144
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 1.71e-7 SMART
WD40 49 88 8.68e-9 SMART
WD40 91 130 2.71e-10 SMART
WD40 133 172 2.43e-12 SMART
WD40 175 214 2.07e-6 SMART
WD40 217 256 1.71e-7 SMART
WD40 259 298 7.55e-9 SMART
coiled coil region 401 441 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159990
SMART Domains Protein: ENSMUSP00000125423
Gene: ENSMUSG00000019952

DomainStartEndE-ValueType
WD40 7 46 8.68e-9 SMART
WD40 49 88 2.71e-10 SMART
WD40 91 130 2.43e-12 SMART
WD40 133 172 2.07e-6 SMART
WD40 175 214 1.71e-7 SMART
WD40 217 256 7.55e-9 SMART
coiled coil region 386 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161240
AA Change: Y33C

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000125315
Gene: ENSMUSG00000090035
AA Change: Y33C

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 135 382 4.7e-10 PFAM
Pfam:Glycos_transf_2 138 321 7.5e-38 PFAM
Pfam:Glyco_tranf_2_2 138 368 1e-7 PFAM
Pfam:Glyco_transf_7C 298 367 4.5e-10 PFAM
low complexity region 411 420 N/A INTRINSIC
RICIN 445 577 2.39e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218379
Predicted Effect probably benign
Transcript: ENSMUST00000219884
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220019
Meta Mutation Damage Score 0.1144 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. In vitro, the encoded protein can complement other GalNAc-Ts in the complete O-glycosylation of the mucin-1 tandem repeat and can O-glycosylate the P-selectin glycoprotein ligand-1 molecule. The coding region of this gene is contained within a single exon. Fusion transcripts, which combine part of this gene with the 5' exons of the neighboring POC1B (POC1 centriolar protein homolog B) gene, also exist. [provided by RefSeq, Dec 2010]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Galnt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Galnt4 APN 10 99109597 missense probably damaging 1.00
IGL01725:Galnt4 APN 10 99109957 missense probably damaging 1.00
IGL01871:Galnt4 APN 10 99109241 missense probably damaging 1.00
IGL02146:Galnt4 APN 10 99109701 missense possibly damaging 0.87
3-1:Galnt4 UTSW 10 99109265 missense probably damaging 1.00
R1318:Galnt4 UTSW 10 99109910 missense probably damaging 0.99
R1466:Galnt4 UTSW 10 99108709 missense probably benign 0.43
R1466:Galnt4 UTSW 10 99108709 missense probably benign 0.43
R1471:Galnt4 UTSW 10 99108674 missense probably benign
R1633:Galnt4 UTSW 10 99109952 missense possibly damaging 0.88
R2088:Galnt4 UTSW 10 99109184 missense probably damaging 1.00
R2197:Galnt4 UTSW 10 99108647 missense probably damaging 1.00
R2363:Galnt4 UTSW 10 99109061 missense probably damaging 1.00
R2507:Galnt4 UTSW 10 99109286 missense possibly damaging 0.78
R3104:Galnt4 UTSW 10 99109381 missense probably benign 0.10
R3106:Galnt4 UTSW 10 99109381 missense probably benign 0.10
R4599:Galnt4 UTSW 10 99109493 missense probably damaging 1.00
R4670:Galnt4 UTSW 10 99109298 missense possibly damaging 0.60
R4756:Galnt4 UTSW 10 99108500 missense probably benign
R5660:Galnt4 UTSW 10 99109535 missense probably benign 0.16
R5819:Galnt4 UTSW 10 99110030 missense probably damaging 1.00
R6441:Galnt4 UTSW 10 99110098 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCTCAAGTGACCCCTGGGAAACTC -3'
(R):5'- CGACCTGTAGTGGAACTTCTTGGC -3'

Sequencing Primer
(F):5'- GAACCTTCTCGGAAGTTCGC -3'
(R):5'- AGTGGAACTTCTTGGCTTTACAC -3'
Posted On2014-06-13