Incidental Mutation 'R0041:Cdhr2'
ID201500
Institutional Source Beutler Lab
Gene Symbol Cdhr2
Ensembl Gene ENSMUSG00000034918
Gene Namecadherin-related family member 2
SynonymsLOC268663, Pcdh24
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R0041 (G1)
Quality Score63
Status Validated
Chromosome13
Chromosomal Location54701461-54736662 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54726838 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 908 (S908C)
Ref Sequence ENSEMBL: ENSMUSP00000043596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037145]
Predicted Effect probably damaging
Transcript: ENSMUST00000037145
AA Change: S908C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043596
Gene: ENSMUSG00000034918
AA Change: S908C

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 48 122 8.62e-15 SMART
CA 146 239 1.4e-2 SMART
CA 263 351 2.19e-16 SMART
CA 391 478 4.22e-9 SMART
CA 503 584 2.15e-24 SMART
CA 605 693 6.78e-22 SMART
CA 715 805 1.78e-16 SMART
CA 830 925 7.57e-11 SMART
CA 950 1042 7.1e-2 SMART
low complexity region 1121 1147 N/A INTRINSIC
transmembrane domain 1153 1175 N/A INTRINSIC
low complexity region 1195 1209 N/A INTRINSIC
low complexity region 1234 1250 N/A INTRINSIC
low complexity region 1264 1277 N/A INTRINSIC
Meta Mutation Damage Score 0.196 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin family, which represents a subset of the larger cadherin superfamily. The members of the protocadherin family encode non-classical cadherins that function as calcium-dependent cell-cell adhesion molecules. This protocadherin represents a new candidate for tumor suppression. Alternatively spliced transcript variants that encode the same protein have been identified. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Cdhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Cdhr2 APN 13 54718299 missense probably damaging 1.00
IGL00596:Cdhr2 APN 13 54720997 missense probably damaging 0.97
IGL00840:Cdhr2 APN 13 54720152 missense probably damaging 0.96
IGL00956:Cdhr2 APN 13 54718343 missense probably damaging 1.00
IGL01101:Cdhr2 APN 13 54718135 splice site probably benign
IGL01150:Cdhr2 APN 13 54731118 missense probably benign
IGL01412:Cdhr2 APN 13 54725894 missense probably damaging 1.00
IGL01515:Cdhr2 APN 13 54718238 missense probably benign 0.17
IGL02005:Cdhr2 APN 13 54719763 missense probably benign 0.00
IGL02187:Cdhr2 APN 13 54733710 missense possibly damaging 0.86
IGL02312:Cdhr2 APN 13 54717888 missense probably null 0.97
IGL02877:Cdhr2 APN 13 54734737 missense probably benign 0.39
IGL03072:Cdhr2 APN 13 54726661 missense probably benign 0.00
IGL03263:Cdhr2 APN 13 54718113 missense possibly damaging 0.75
FR4449:Cdhr2 UTSW 13 54725924 small insertion probably benign
PIT4494001:Cdhr2 UTSW 13 54718442 critical splice acceptor site probably null
PIT4498001:Cdhr2 UTSW 13 54718239 missense possibly damaging 0.75
R0149:Cdhr2 UTSW 13 54734007 missense probably damaging 1.00
R0329:Cdhr2 UTSW 13 54734801 unclassified probably benign
R0361:Cdhr2 UTSW 13 54734007 missense probably damaging 1.00
R0365:Cdhr2 UTSW 13 54718292 missense probably benign 0.00
R0598:Cdhr2 UTSW 13 54726739 missense probably damaging 1.00
R0774:Cdhr2 UTSW 13 54717855 missense probably damaging 1.00
R1330:Cdhr2 UTSW 13 54734268 missense possibly damaging 0.67
R1458:Cdhr2 UTSW 13 54717872 missense probably damaging 0.99
R1659:Cdhr2 UTSW 13 54719761 missense probably damaging 1.00
R1698:Cdhr2 UTSW 13 54719581 missense probably benign 0.00
R2061:Cdhr2 UTSW 13 54720818 missense probably damaging 1.00
R2098:Cdhr2 UTSW 13 54715644 missense probably benign 0.15
R2135:Cdhr2 UTSW 13 54720947 missense probably damaging 1.00
R2365:Cdhr2 UTSW 13 54718088 missense probably benign 0.01
R3693:Cdhr2 UTSW 13 54726416 missense probably damaging 1.00
R3968:Cdhr2 UTSW 13 54726458 missense probably damaging 1.00
R3970:Cdhr2 UTSW 13 54726458 missense probably damaging 1.00
R4001:Cdhr2 UTSW 13 54718266 missense probably benign 0.09
R4003:Cdhr2 UTSW 13 54718266 missense probably benign 0.09
R4030:Cdhr2 UTSW 13 54717861 missense probably damaging 1.00
R4088:Cdhr2 UTSW 13 54717888 missense probably null 0.97
R4256:Cdhr2 UTSW 13 54714005 missense probably damaging 0.99
R4322:Cdhr2 UTSW 13 54733721 missense probably benign 0.00
R4396:Cdhr2 UTSW 13 54715665 missense probably damaging 0.99
R4591:Cdhr2 UTSW 13 54715684 missense probably benign 0.18
R4726:Cdhr2 UTSW 13 54718539 missense probably damaging 0.99
R5370:Cdhr2 UTSW 13 54720887 missense probably damaging 1.00
R5396:Cdhr2 UTSW 13 54736456 missense probably benign
R5447:Cdhr2 UTSW 13 54733250 missense probably damaging 1.00
R5654:Cdhr2 UTSW 13 54736536 missense probably benign
R5727:Cdhr2 UTSW 13 54724308 missense possibly damaging 0.95
R5771:Cdhr2 UTSW 13 54726695 missense probably damaging 0.99
R5924:Cdhr2 UTSW 13 54726683 missense probably benign 0.01
R5928:Cdhr2 UTSW 13 54734019 missense probably benign 0.01
R6246:Cdhr2 UTSW 13 54719710 missense probably damaging 1.00
R6351:Cdhr2 UTSW 13 54726776 missense probably benign 0.16
R6358:Cdhr2 UTSW 13 54736546 missense probably damaging 0.99
R6433:Cdhr2 UTSW 13 54718512 missense probably damaging 0.97
R7044:Cdhr2 UTSW 13 54733321 nonsense probably null
R7341:Cdhr2 UTSW 13 54719492 missense probably damaging 0.99
R7462:Cdhr2 UTSW 13 54726739 missense probably damaging 1.00
R7488:Cdhr2 UTSW 13 54717915 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- ACTGCTGCGTTGCTGAGGATAGAG -3'
(R):5'- TGCTTCCAGGCAATCCACTGAAC -3'

Sequencing Primer
(F):5'- ACGTCATCTGCACCAAGG -3'
(R):5'- GAACACCATGTTCAAATGCTTTCAC -3'
Posted On2014-06-13