Incidental Mutation 'R0041:Rock1'
ID201504
Institutional Source Beutler Lab
Gene Symbol Rock1
Ensembl Gene ENSMUSG00000024290
Gene NameRho-associated coiled-coil containing protein kinase 1
Synonyms1110055K06Rik, Rock-I
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock #R0041 (G1)
Quality Score76
Status Validated
Chromosome18
Chromosomal Location10064401-10181792 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10140240 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 117 (D117G)
Ref Sequence ENSEMBL: ENSMUSP00000069549 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067947]
Predicted Effect probably damaging
Transcript: ENSMUST00000067947
AA Change: D117G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069549
Gene: ENSMUSG00000024290
AA Change: D117G

DomainStartEndE-ValueType
S_TKc 76 338 4.07e-97 SMART
S_TK_X 341 401 4.02e-9 SMART
low complexity region 408 419 N/A INTRINSIC
PDB:3O0Z|D 535 700 1e-101 PDB
low complexity region 715 731 N/A INTRINSIC
PDB:4L2W|B 832 914 7e-28 PDB
Pfam:Rho_Binding 948 1014 4.3e-26 PFAM
PH 1119 1319 1.19e-6 SMART
C1 1229 1283 2.64e-10 SMART
Meta Mutation Damage Score 0.456 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein serine/threonine kinase that is activated when bound to the GTP-bound form of Rho. The small GTPase Rho regulates formation of focal adhesions and stress fibers of fibroblasts, as well as adhesion and aggregation of platelets and lymphocytes by shuttling between the inactive GDP-bound form and the active GTP-bound form. Rho is also essential in cytokinesis and plays a role in transcriptional activation by serum response factor. This protein, a downstream effector of Rho, phosphorylates and activates LIM kinase, which in turn, phosphorylates cofilin, inhibiting its actin-depolymerizing activity. A pseudogene, related to this gene, is also located on chromosome 18. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have open eyes at birth, omphalocele and most die soon after birth as a result of cannibalization by the mom. Survivors develop inflammation of the eyelid. Another homozygous mutant shows partial lethality around implantation and reduced cardiac fibrosis after pressure overload. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Efna5 A T 17: 62,607,472 probably benign Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Rock1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Rock1 APN 18 10080502 missense probably benign 0.44
IGL01535:Rock1 APN 18 10132119 splice site probably benign
IGL01751:Rock1 APN 18 10079113 critical splice donor site probably null
IGL01752:Rock1 APN 18 10079113 critical splice donor site probably null
IGL02318:Rock1 APN 18 10104323 splice site probably benign
IGL02420:Rock1 APN 18 10070619 splice site probably null
IGL03030:Rock1 APN 18 10070215 splice site probably benign
IGL03339:Rock1 APN 18 10097493 missense probably benign 0.00
R0010:Rock1 UTSW 18 10084380 missense probably damaging 0.99
R0010:Rock1 UTSW 18 10084380 missense probably damaging 0.99
R0041:Rock1 UTSW 18 10140240 missense probably damaging 1.00
R0480:Rock1 UTSW 18 10079120 missense possibly damaging 0.92
R0538:Rock1 UTSW 18 10132227 missense possibly damaging 0.53
R0719:Rock1 UTSW 18 10099328 missense probably damaging 1.00
R1033:Rock1 UTSW 18 10067535 missense probably benign 0.12
R1448:Rock1 UTSW 18 10070233 missense probably damaging 1.00
R1465:Rock1 UTSW 18 10072863 missense possibly damaging 0.80
R1465:Rock1 UTSW 18 10072863 missense possibly damaging 0.80
R1470:Rock1 UTSW 18 10136091 splice site probably null
R1470:Rock1 UTSW 18 10136091 splice site probably null
R1694:Rock1 UTSW 18 10136094 critical splice donor site probably null
R1862:Rock1 UTSW 18 10079207 missense probably damaging 0.99
R1995:Rock1 UTSW 18 10101026 nonsense probably null
R2177:Rock1 UTSW 18 10070263 missense probably benign 0.18
R2892:Rock1 UTSW 18 10072863 nonsense probably null
R3780:Rock1 UTSW 18 10067575 missense probably benign 0.00
R3884:Rock1 UTSW 18 10122768 missense probably damaging 1.00
R4352:Rock1 UTSW 18 10079237 missense probably damaging 1.00
R4414:Rock1 UTSW 18 10080514 missense probably damaging 1.00
R4646:Rock1 UTSW 18 10112391 missense probably benign
R4694:Rock1 UTSW 18 10136152 nonsense probably null
R4888:Rock1 UTSW 18 10122698 missense probably benign 0.06
R5085:Rock1 UTSW 18 10140210 missense probably damaging 1.00
R5884:Rock1 UTSW 18 10099361 missense probably benign 0.03
R5927:Rock1 UTSW 18 10116792 missense probably damaging 1.00
R6084:Rock1 UTSW 18 10101007 missense probably benign 0.15
R6151:Rock1 UTSW 18 10106426 missense possibly damaging 0.79
R6360:Rock1 UTSW 18 10116778 missense possibly damaging 0.52
R6892:Rock1 UTSW 18 10122612 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGCCAACACAGGATATTTGTTGACT -3'
(R):5'- ACATACATGATGGGACAGACTGGGAA -3'

Sequencing Primer
(F):5'- TTGTTGACTCAGAGAAACTCAACC -3'
(R):5'- TTACCTAATTGTGATAAGCAGAAGAG -3'
Posted On2014-06-13