Incidental Mutation 'R0628:Nfix'
ID201517
Institutional Source Beutler Lab
Gene Symbol Nfix
Ensembl Gene ENSMUSG00000001911
Gene Namenuclear factor I/X
Synonyms
MMRRC Submission 038817-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R0628 (G1)
Quality Score74
Status Validated
Chromosome8
Chromosomal Location84699876-84800344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84726526 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 300 (R300C)
Ref Sequence ENSEMBL: ENSMUSP00000115691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000098571] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]
Predicted Effect probably damaging
Transcript: ENSMUST00000076715
AA Change: R300C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911
AA Change: R300C

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.1e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 322 7.4e-32 PFAM
Pfam:CTF_NFI 313 396 3.8e-19 PFAM
Predicted Effect silent
Transcript: ENSMUST00000098571
SMART Domains Protein: ENSMUSP00000096170
Gene: ENSMUSG00000074203

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 91 103 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099070
AA Change: R300C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911
AA Change: R300C

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.7e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 437 2.7e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109762
AA Change: R291C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911
AA Change: R291C

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.1e-27 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 312 5.4e-32 PFAM
Pfam:CTF_NFI 305 387 3.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109764
AA Change: R292C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911
AA Change: R292C

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1e-28 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 494 9.8e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126806
AA Change: R300C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911
AA Change: R300C

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 7.1e-31 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 488 1.5e-83 PFAM
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.6%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik T C 5: 109,678,576 probably null Het
Alpk2 A C 18: 65,307,296 V809G possibly damaging Het
Bank1 T A 3: 136,066,390 D493V probably damaging Het
Camk2d T C 3: 126,810,624 probably benign Het
Ccdc17 T A 4: 116,598,548 L292H probably damaging Het
Ccdc7b A G 8: 129,111,017 probably benign Het
Cd34 C A 1: 194,959,217 T317K probably damaging Het
Col6a5 C G 9: 105,912,450 probably null Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Copa T C 1: 172,091,025 probably benign Het
Coq7 T C 7: 118,529,644 D56G probably damaging Het
Dlg4 C T 11: 70,031,784 T201I probably damaging Het
Dnah7a T A 1: 53,497,105 D2593V probably benign Het
Ect2l T A 10: 18,143,040 E536V probably damaging Het
Emilin3 A G 2: 160,910,879 probably benign Het
Eml2 T C 7: 19,201,554 probably benign Het
Fam135b C T 15: 71,448,656 probably benign Het
Fam160b2 T C 14: 70,587,721 T392A possibly damaging Het
Gart C T 16: 91,633,902 R424H probably benign Het
Gm9745 T A 13: 8,940,922 probably benign Het
Gramd1a A G 7: 31,142,624 L80P probably damaging Het
Herc1 A G 9: 66,450,881 K2415E probably benign Het
Ica1 C T 6: 8,644,256 probably benign Het
Iyd A T 10: 3,547,127 M161L probably damaging Het
Kdm5a T C 6: 120,415,239 L974S probably damaging Het
Kif1a T C 1: 93,019,883 D1619G probably damaging Het
Lypd8 C T 11: 58,384,673 T78M probably damaging Het
March10 T A 11: 105,390,160 H433L probably benign Het
Mbp A G 18: 82,554,617 Y13C probably damaging Het
Mertk A T 2: 128,738,313 N229I probably damaging Het
Msrb2 T A 2: 19,393,280 D116E probably damaging Het
Otoa G A 7: 121,145,650 probably benign Het
Pclo A G 5: 14,669,538 T1230A unknown Het
Polrmt T C 10: 79,739,145 T851A possibly damaging Het
Prpf6 C T 2: 181,636,048 P401L probably damaging Het
Rasgrp4 A G 7: 29,140,210 probably benign Het
Rc3h2 A T 2: 37,382,052 probably benign Het
Reps1 A G 10: 18,121,093 T588A probably damaging Het
Rtel1 A C 2: 181,351,881 S782R probably benign Het
Sacm1l A G 9: 123,548,995 probably benign Het
Skint5 A T 4: 113,731,069 L728* probably null Het
Slc9b2 T A 3: 135,323,775 probably benign Het
Snapc3 A T 4: 83,450,160 H298L probably benign Het
Tex9 A T 9: 72,491,951 M1K probably null Het
Trappc13 C T 13: 104,154,916 probably benign Het
Ttc37 G C 13: 76,150,729 V1185L possibly damaging Het
Usp3 C T 9: 66,518,444 R467H probably benign Het
Vmn2r11 T A 5: 109,047,731 L576F possibly damaging Het
Wnk4 T C 11: 101,275,023 F792S probably benign Het
Zfp280d T C 9: 72,361,948 V764A probably benign Het
Zfp69 G A 4: 120,949,425 Q4* probably null Het
Zfp692 T G 11: 58,309,623 L206R probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Zic4 T A 9: 91,384,117 Y264* probably null Het
Zic4 T A 9: 91,384,119 M272K probably benign Het
Zscan4b A T 7: 10,901,463 N284K probably damaging Het
Other mutations in Nfix
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nfix APN 8 84726477 missense probably damaging 0.99
IGL01919:Nfix APN 8 84726474 missense probably damaging 1.00
IGL01950:Nfix APN 8 84713786 makesense probably null
IGL02862:Nfix APN 8 84713846 missense probably benign 0.07
R0142:Nfix UTSW 8 84721686 missense probably damaging 1.00
R0309:Nfix UTSW 8 84721774 missense probably damaging 1.00
R0600:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0622:Nfix UTSW 8 84726482 missense probably damaging 0.99
R0882:Nfix UTSW 8 84727925 missense probably damaging 1.00
R0893:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0975:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1014:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1015:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1162:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1241:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1381:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1513:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1521:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1618:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1865:Nfix UTSW 8 84772275 missense possibly damaging 0.73
R1912:Nfix UTSW 8 84721677 missense probably damaging 1.00
R1974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R2208:Nfix UTSW 8 84716247 frame shift probably null
R2251:Nfix UTSW 8 84716170 missense probably benign 0.03
R2268:Nfix UTSW 8 84716247 frame shift probably null
R2270:Nfix UTSW 8 84716247 frame shift probably null
R2272:Nfix UTSW 8 84727175 missense probably damaging 1.00
R2346:Nfix UTSW 8 84716247 frame shift probably null
R2350:Nfix UTSW 8 84716247 frame shift probably null
R2963:Nfix UTSW 8 84716247 frame shift probably null
R2983:Nfix UTSW 8 84716247 frame shift probably null
R3008:Nfix UTSW 8 84716247 frame shift probably null
R3727:Nfix UTSW 8 84716247 frame shift probably null
R3791:Nfix UTSW 8 84716247 frame shift probably null
R4163:Nfix UTSW 8 84716247 frame shift probably null
R4164:Nfix UTSW 8 84716247 frame shift probably null
R4201:Nfix UTSW 8 84716247 frame shift probably null
R4206:Nfix UTSW 8 84716247 frame shift probably null
R4609:Nfix UTSW 8 84726490 missense probably damaging 1.00
R4801:Nfix UTSW 8 84716247 frame shift probably null
R4802:Nfix UTSW 8 84716247 frame shift probably null
R4914:Nfix UTSW 8 84771829 missense probably benign 0.00
R4915:Nfix UTSW 8 84771829 missense probably benign 0.00
R4916:Nfix UTSW 8 84771829 missense probably benign 0.00
R4918:Nfix UTSW 8 84771829 missense probably benign 0.00
R5013:Nfix UTSW 8 84772084 missense possibly damaging 0.86
R5290:Nfix UTSW 8 84713777 nonsense probably null
R6418:Nfix UTSW 8 84727149 missense probably benign 0.01
R6554:Nfix UTSW 8 84727650 missense possibly damaging 0.93
R6786:Nfix UTSW 8 84727647 missense probably damaging 1.00
T0970:Nfix UTSW 8 84726483 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GATCTATGAAGAAGAGGCCATGCCC -3'
(R):5'- TGGAGATGCTCTGCTCCTAGAACTG -3'

Sequencing Primer
(F):5'- ACTATAGGCTTGGTAGCCGTC -3'
(R):5'- GCTCCTAGAACTGGGGTGC -3'
Posted On2014-06-16