Incidental Mutation 'R0676:Slc22a23'
ID201535
Institutional Source Beutler Lab
Gene Symbol Slc22a23
Ensembl Gene ENSMUSG00000038267
Gene Namesolute carrier family 22, member 23
Synonyms3110004L20Rik
MMRRC Submission 038861-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R0676 (G1)
Quality Score66
Status Validated
Chromosome13
Chromosomal Location34179158-34345182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34195479 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 435 (T435I)
Ref Sequence ENSEMBL: ENSMUSP00000042742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040336]
Predicted Effect probably damaging
Transcript: ENSMUST00000040336
AA Change: T435I

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000042742
Gene: ENSMUSG00000038267
AA Change: T435I

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
Pfam:Sugar_tr 187 633 5e-26 PFAM
Pfam:MFS_1 224 518 2.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128392
Predicted Effect unknown
Transcript: ENSMUST00000148390
AA Change: T319I
SMART Domains Protein: ENSMUSP00000122283
Gene: ENSMUSG00000038267
AA Change: T319I

DomainStartEndE-ValueType
low complexity region 38 49 N/A INTRINSIC
Pfam:Sugar_tr 71 510 1.4e-27 PFAM
Pfam:MFS_1 109 402 1.5e-12 PFAM
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC22A23 belongs to a large family of transmembrane proteins that function as uniporters, symporters, and antiporters to transport organic ions across cell membranes (Jacobsson et al., 2007 [PubMed 17714910]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik A G 5: 87,964,657 probably benign Het
Arhgef25 A G 10: 127,184,010 probably null Het
B3galnt2 T C 13: 13,995,793 S243P probably benign Het
Col11a2 A G 17: 34,057,275 N799D probably damaging Het
Cpb1 T C 3: 20,266,533 probably null Het
Crot A C 5: 8,993,622 probably benign Het
Ctnna3 A C 10: 64,409,261 H451P probably benign Het
Cts6 C T 13: 61,197,484 probably benign Het
Dock2 T C 11: 34,695,236 T540A probably damaging Het
Dysf C A 6: 84,113,336 F956L probably benign Het
Gabrg3 A T 7: 56,724,421 Y466N probably damaging Het
Gm10845 T A 14: 79,863,204 noncoding transcript Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
Hist1h4i T C 13: 22,041,106 probably null Het
Il1rl1 CTTGTTGTTGTTGTTGTTG CTTGTTGTTGTTGTTGTTGTTG 1: 40,442,574 probably benign Het
Immt A G 6: 71,851,844 S128G probably benign Het
Klb A T 5: 65,379,055 D576V probably damaging Het
Lpin1 A T 12: 16,540,979 N817K possibly damaging Het
Lrrk1 C T 7: 66,294,981 R627H probably damaging Het
Luzp1 A G 4: 136,542,685 K740E probably damaging Het
Mapk9 T C 11: 49,883,156 *382Q probably null Het
Mn1 A G 5: 111,421,034 S957G possibly damaging Het
Mrgprb8 A T 7: 48,388,664 M28L probably benign Het
Myo1a A G 10: 127,719,880 I913V probably benign Het
Nolc1 T A 19: 46,080,089 probably benign Het
Pde4dip A C 3: 97,717,097 probably benign Het
Rbpj C T 5: 53,646,048 probably benign Het
Ric1 T C 19: 29,577,647 I387T probably benign Het
Ruvbl1 A G 6: 88,473,200 R58G probably damaging Het
Scarb1 C A 5: 125,297,214 probably benign Het
Sh3tc1 A T 5: 35,719,114 probably benign Het
Slc22a26 A T 19: 7,796,144 probably benign Het
Taf6l T C 19: 8,773,369 I114V probably benign Het
Tbc1d8b A G X: 139,712,276 S284G possibly damaging Het
Tmem131l C T 3: 83,934,815 probably benign Het
Vmn2r115 C T 17: 23,346,264 S375F probably benign Het
Other mutations in Slc22a23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Slc22a23 APN 13 34305245 missense probably damaging 1.00
IGL01762:Slc22a23 APN 13 34204001 missense possibly damaging 0.71
IGL02496:Slc22a23 APN 13 34344485 missense possibly damaging 0.93
IGL02516:Slc22a23 APN 13 34203955 missense probably benign 0.02
IGL02831:Slc22a23 APN 13 34299069 missense possibly damaging 0.81
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0234:Slc22a23 UTSW 13 34183261 missense probably damaging 1.00
R0413:Slc22a23 UTSW 13 34183132 missense probably damaging 1.00
R0557:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0558:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0636:Slc22a23 UTSW 13 34299093 missense probably benign 0.01
R0739:Slc22a23 UTSW 13 34344383 missense possibly damaging 0.50
R0990:Slc22a23 UTSW 13 34195467 missense probably damaging 1.00
R1515:Slc22a23 UTSW 13 34203964 missense probably benign 0.33
R2128:Slc22a23 UTSW 13 34203970 missense possibly damaging 0.76
R2147:Slc22a23 UTSW 13 34183007 missense probably benign 0.00
R3113:Slc22a23 UTSW 13 34183075 missense probably damaging 0.98
R3780:Slc22a23 UTSW 13 34344340 missense probably benign 0.14
R3945:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R3946:Slc22a23 UTSW 13 34183126 missense probably damaging 0.98
R4056:Slc22a23 UTSW 13 34299004 nonsense probably null
R4095:Slc22a23 UTSW 13 34305206 missense probably damaging 1.00
R4854:Slc22a23 UTSW 13 34203941 missense probably benign
R5594:Slc22a23 UTSW 13 34305257 missense probably damaging 0.99
R5611:Slc22a23 UTSW 13 34305239 missense probably benign 0.00
R6167:Slc22a23 UTSW 13 34344559 missense probably damaging 0.97
R6927:Slc22a23 UTSW 13 34344379 missense probably benign 0.07
R6933:Slc22a23 UTSW 13 34305180 missense probably benign 0.08
R6960:Slc22a23 UTSW 13 34344157 critical splice donor site probably null
X0064:Slc22a23 UTSW 13 34344466 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTACTCACAGTTGAGAAGCCC -3'
(R):5'- GCTTTGTCCTACACCCTTGGTGAAC -3'

Sequencing Primer
(F):5'- GTTGAGAAGCCCGAGCTG -3'
(R):5'- CTTGGTGAACAAAAATACCTCAAGG -3'
Posted On2014-06-19