Incidental Mutation 'Y5404:Syt4'
ID201545
Institutional Source Beutler Lab
Gene Symbol Syt4
Ensembl Gene ENSMUSG00000024261
Gene Namesynaptotagmin IV
Synonyms
Accession Numbers

Genbank: NM_009308; MGI: 101759  

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #Y5404 ()
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location31437808-31447415 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31443791 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 170 (F170S)
Ref Sequence ENSEMBL: ENSMUSP00000025110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025110]
Predicted Effect probably damaging
Transcript: ENSMUST00000025110
AA Change: F170S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025110
Gene: ENSMUSG00000024261
AA Change: F170S

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 68 79 N/A INTRINSIC
low complexity region 137 150 N/A INTRINSIC
C2 169 273 1.5e-19 SMART
C2 303 417 3.5e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181067
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.5%
  • 10x: 94.0%
  • 20x: 88.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the synaptotagmin family. Members of this family are multi-domained, integral membrane proteins of synaptic vesicles, and are thought to serve as Ca2+ sensors in the process of vesicular trafficking and exocytosis. This gene is primarily expressed in the nervous tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impairments in motor coordination, contextual fear conditioning, and social transmission of food preference. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 4 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bbs1 T C 19: 4,900,607 M203V possibly damaging Het
Drc7 GGATGATGATGATGATGATG GGATGATGATGATGATG 8: 95,068,150 probably benign Het
Gm4978 T G 9: 69,450,702 probably benign Het
Rpf1 T C 3: 146,512,836 T148A probably damaging Het
Other mutations in Syt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Syt4 APN 18 31447174 utr 5 prime probably benign
IGL01476:Syt4 APN 18 31441643 missense probably damaging 1.00
IGL02412:Syt4 APN 18 31443843 missense probably benign 0.19
IGL02550:Syt4 APN 18 31444193 missense probably damaging 1.00
IGL02996:Syt4 APN 18 31444146 missense probably damaging 1.00
F6893:Syt4 UTSW 18 31444221 missense possibly damaging 0.74
R0103:Syt4 UTSW 18 31447220 start gained probably benign
R0526:Syt4 UTSW 18 31443746 missense possibly damaging 0.95
R1122:Syt4 UTSW 18 31440202 missense probably damaging 1.00
R1622:Syt4 UTSW 18 31444016 missense probably damaging 1.00
R1786:Syt4 UTSW 18 31443443 splice site probably benign
R1895:Syt4 UTSW 18 31444088 missense probably damaging 1.00
R2114:Syt4 UTSW 18 31440467 missense probably damaging 1.00
R2117:Syt4 UTSW 18 31440467 missense probably damaging 1.00
R2655:Syt4 UTSW 18 31443544 missense probably benign 0.01
R3079:Syt4 UTSW 18 31441685 missense probably benign 0.08
R3730:Syt4 UTSW 18 31444136 missense probably damaging 0.96
R4870:Syt4 UTSW 18 31447356 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCAAGGAGAGCTCTTGGATG -3'
(R):5'- GACCTCAATGGCAACTTCCC -3'

Sequencing Primer
(F):5'- TGTGGGGATAAGGGATTCCATAG -3'
(R):5'- TCAATGGCAACTTCCCCAAAG -3'
Posted On2014-06-23