Mutagenetix > Incidental Mutation

Incidental Mutation 'Y5404:Bbs1'

201546

Institutional Source

Beutler Lab

Gene Symbol

Bbs1

Ensembl Gene

ENSMUSG00000006464

Gene Name

Bardet-Biedl syndrome 1

Synonyms

D19Ertd609e

Accession Numbers

Essential gene?

Probably essential (E-score: 0.824) question?

Stock #

Y5404 ()

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

4936906-4956656 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 4950635 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 203 (M203V)

Ref Sequence

ENSEMBL: ENSMUSP00000055321 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053506]

AlphaFold

Q3V3N7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000053506
AA Change: M203V

PolyPhen 2 Score 0.489 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000055321
Gene: ENSMUSG00000006464
AA Change: M203V

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
Pfam:BBS1	23	276	2.7e-104	PFAM
low complexity region	293	305	N/A	INTRINSIC
low complexity region	458	466	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158036

Coding Region Coverage

1x: 97.3%
3x: 96.5%
10x: 94.0%
20x: 88.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene have been observed in patients with the major form (type 1) of Bardet-Biedl syndrome. The encoded protein may play a role in eye, limb, cardiac and reproductive system development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display partial embryonic lethality, low body weight before weaning, obesity after weaning, retinal degeneration, and abnormal olfactory epithelium and neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 4 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Drc7	GGATGATGATGATGATGATG	GGATGATGATGATGATG	8: 95,794,778 (GRCm39)		probably benign	Het
Gm4978	T	G	9: 69,357,984 (GRCm39)		probably benign	Het
Rpf1	T	C	3: 146,218,591 (GRCm39)	T148A	probably damaging	Het
Syt4	A	G	18: 31,576,844 (GRCm39)	F170S	probably damaging	Het

Other mutations in Bbs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Bbs1	APN	19	4,943,038 (GRCm39)	missense	probably benign
IGL01110:Bbs1	APN	19	4,942,953 (GRCm39)	missense	possibly damaging	0.93
IGL01116:Bbs1	APN	19	4,952,867 (GRCm39)	splice site	probably benign
IGL01480:Bbs1	APN	19	4,944,421 (GRCm39)	missense	probably damaging	1.00
IGL01926:Bbs1	APN	19	4,952,891 (GRCm39)	missense	probably benign	0.01
IGL02893:Bbs1	APN	19	4,947,604 (GRCm39)	nonsense	probably null
IGL03136:Bbs1	APN	19	4,941,019 (GRCm39)	missense	probably benign	0.10
IGL03342:Bbs1	APN	19	4,947,621 (GRCm39)	missense	probably damaging	1.00
bookface	UTSW	19	4,947,354 (GRCm39)	missense	possibly damaging	0.81
PIT4131001:Bbs1	UTSW	19	4,949,287 (GRCm39)	missense	possibly damaging	0.83
PIT4378001:Bbs1	UTSW	19	4,941,703 (GRCm39)	missense	probably benign	0.05
PIT4468001:Bbs1	UTSW	19	4,956,190 (GRCm39)	missense	probably benign	0.19
R0023:Bbs1	UTSW	19	4,956,042 (GRCm39)	missense	probably damaging	1.00
R0023:Bbs1	UTSW	19	4,956,042 (GRCm39)	missense	probably damaging	1.00
R0127:Bbs1	UTSW	19	4,945,057 (GRCm39)	missense	probably benign	0.05
R1423:Bbs1	UTSW	19	4,944,291 (GRCm39)	missense	probably benign	0.08
R1760:Bbs1	UTSW	19	4,944,350 (GRCm39)	missense	probably benign	0.10
R1992:Bbs1	UTSW	19	4,941,736 (GRCm39)	missense	probably benign
R2145:Bbs1	UTSW	19	4,953,735 (GRCm39)	missense	possibly damaging	0.71
R4097:Bbs1	UTSW	19	4,947,345 (GRCm39)	missense	probably damaging	1.00
R5717:Bbs1	UTSW	19	4,947,354 (GRCm39)	missense	possibly damaging	0.81
R5947:Bbs1	UTSW	19	4,943,022 (GRCm39)	missense	probably benign	0.27
R6005:Bbs1	UTSW	19	4,953,823 (GRCm39)	nonsense	probably null
R6175:Bbs1	UTSW	19	4,940,749 (GRCm39)	missense	probably damaging	1.00
R6597:Bbs1	UTSW	19	4,949,334 (GRCm39)	missense	probably benign	0.01
R6734:Bbs1	UTSW	19	4,953,924 (GRCm39)	missense	probably benign	0.10
R6772:Bbs1	UTSW	19	4,956,618 (GRCm39)	unclassified	probably benign
R6805:Bbs1	UTSW	19	4,950,643 (GRCm39)	missense	probably damaging	1.00
R6838:Bbs1	UTSW	19	4,953,880 (GRCm39)	missense	possibly damaging	0.47
R7198:Bbs1	UTSW	19	4,945,043 (GRCm39)	missense	probably damaging	0.97
R7276:Bbs1	UTSW	19	4,947,738 (GRCm39)	splice site	probably null
R7685:Bbs1	UTSW	19	4,956,182 (GRCm39)	missense	probably benign	0.43
R7696:Bbs1	UTSW	19	4,941,017 (GRCm39)	critical splice donor site	probably null
R7933:Bbs1	UTSW	19	4,941,678 (GRCm39)	splice site	probably benign
R8446:Bbs1	UTSW	19	4,947,633 (GRCm39)	missense	probably benign	0.05
R8892:Bbs1	UTSW	19	4,942,954 (GRCm39)	missense	probably benign	0.05
R9181:Bbs1	UTSW	19	4,941,070 (GRCm39)	missense	possibly damaging	0.64
R9602:Bbs1	UTSW	19	4,941,083 (GRCm39)	missense	probably damaging	1.00
Y5407:Bbs1	UTSW	19	4,950,635 (GRCm39)	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- AATAGATGCTACCCACACTGG -3'
(R):5'- CCGAGTTGGTTTTGACTCTGTAAC -3'

Sequencing Primer
(F):5'- CCACACTGGGAGAGCAGG -3'
(R):5'- TGACTCTGTAACTCATAAGTGGC -3'

Posted On

2014-06-23