Incidental Mutation 'R1789:Col5a2'
ID201574
Institutional Source Beutler Lab
Gene Symbol Col5a2
Ensembl Gene ENSMUSG00000026042
Gene Namecollagen, type V, alpha 2
Synonyms1110014L14Rik
MMRRC Submission 039820-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1789 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location45374321-45503282 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45394776 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 759 (Q759R)
Ref Sequence ENSEMBL: ENSMUSP00000083620 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086430]
Predicted Effect probably damaging
Transcript: ENSMUST00000086430
AA Change: Q759R

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000083620
Gene: ENSMUSG00000026042
AA Change: Q759R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 40 95 9.94e-23 SMART
Pfam:Collagen 123 186 1.5e-10 PFAM
Pfam:Collagen 207 272 2.9e-9 PFAM
low complexity region 319 347 N/A INTRINSIC
internal_repeat_1 349 421 3.18e-18 PROSPERO
internal_repeat_2 385 422 1.34e-12 PROSPERO
internal_repeat_5 388 423 1.55e-7 PROSPERO
low complexity region 424 460 N/A INTRINSIC
low complexity region 471 508 N/A INTRINSIC
internal_repeat_6 509 535 5.68e-7 PROSPERO
internal_repeat_2 511 548 1.34e-12 PROSPERO
internal_repeat_3 520 549 1.16e-11 PROSPERO
internal_repeat_1 520 571 3.18e-18 PROSPERO
internal_repeat_4 546 574 4.91e-9 PROSPERO
low complexity region 595 611 N/A INTRINSIC
internal_repeat_7 616 741 1.35e-6 PROSPERO
low complexity region 742 757 N/A INTRINSIC
Pfam:Collagen 790 870 4.8e-8 PFAM
low complexity region 877 898 N/A INTRINSIC
Pfam:Collagen 907 979 4.2e-8 PFAM
internal_repeat_4 993 1021 4.91e-9 PROSPERO
internal_repeat_3 994 1023 1.16e-11 PROSPERO
low complexity region 1024 1054 N/A INTRINSIC
internal_repeat_6 1055 1078 5.68e-7 PROSPERO
low complexity region 1081 1096 N/A INTRINSIC
Pfam:Collagen 1111 1171 9.7e-12 PFAM
Pfam:Collagen 1168 1230 1.4e-9 PFAM
COLFI 1263 1497 1.83e-164 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150143
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of type V collagen, one of the low abundance fibrillar collagens that gets incorporated into growing fibrils with type I collagen. The encoded protein, in association with alpha-1 and/or alpha-3 subunits, forms homo- or heterotrimeric type V procollagen that undergoes proteolytic processing. Mice lacking the encoded protein die in utero. Transgenic mice that produce a structurally abnormal form of the encoded protein survive poorly and exhibit skin fragility, skeletal abnormalities and alterations in the collagen fiber organization. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant animals exhibit reduced body weight, reduced bone growth rate, thin, fragile skin, variable degrees of lordosis and kyphosis, abnormal localization of hair follicles in the dermis, and thinned stroma of the cornea. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,365,951 P986L probably damaging Het
Acad10 A T 5: 121,631,393 Y667N possibly damaging Het
Ahi1 G A 10: 20,963,115 G121D probably benign Het
Ampd1 T A 3: 103,099,126 I690N possibly damaging Het
Amy1 C A 3: 113,558,165 W425L possibly damaging Het
Arhgap27 A T 11: 103,333,005 V823E probably damaging Het
Arhgef17 A G 7: 100,929,870 S624P probably damaging Het
Arid5b T C 10: 68,186,067 H231R probably damaging Het
Aspscr1 C A 11: 120,688,560 T78N probably damaging Het
Auts2 T A 5: 131,472,450 T42S probably damaging Het
Ccdc171 A G 4: 83,554,808 D158G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap61 T C 2: 145,939,993 probably null Het
Chrna5 T C 9: 55,004,651 V245A possibly damaging Het
Cntnap5c G A 17: 58,013,921 G163R probably damaging Het
Comp A G 8: 70,377,146 D340G probably benign Het
Cyfip1 T A 7: 55,926,395 D1104E probably damaging Het
Dnah11 A T 12: 118,038,780 S308T probably damaging Het
Dnah5 A G 15: 28,270,426 H958R probably benign Het
Elp3 A G 14: 65,547,919 Y478H probably damaging Het
Fat3 T C 9: 16,376,985 Y414C probably benign Het
Fbxo10 C A 4: 45,046,389 A574S probably damaging Het
Fsip2 G T 2: 82,977,562 L1408F probably benign Het
Fubp3 T C 2: 31,611,735 V425A possibly damaging Het
Gm7168 A T 17: 13,949,584 R404S probably benign Het
Gm8773 A T 5: 5,575,652 Q116L possibly damaging Het
Gpd1 T G 15: 99,723,202 F299C probably damaging Het
Gpr137 C T 19: 6,942,057 probably benign Het
Grin3b T C 10: 79,973,408 S331P probably benign Het
Grk3 T A 5: 112,941,718 I281F probably damaging Het
Hoxb7 T A 11: 96,286,781 S18R probably damaging Het
Igf1r C T 7: 68,214,933 R1160* probably null Het
Itfg1 A G 8: 85,725,512 probably null Het
Itgb8 T C 12: 119,202,455 I114V probably benign Het
Kcnk1 A G 8: 126,025,384 E243G possibly damaging Het
Kif27 A G 13: 58,344,008 L439P probably damaging Het
Kif2c T A 4: 117,167,361 Q279L probably benign Het
Kmt2d A T 15: 98,852,074 probably benign Het
L3mbtl1 A G 2: 162,974,502 T821A probably benign Het
Lrrc24 A T 15: 76,722,578 M206K probably benign Het
Mamdc4 T G 2: 25,567,622 K460Q possibly damaging Het
Maml2 C G 9: 13,697,345 L30V probably damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Myo10 T G 15: 25,726,525 probably null Het
Myo1e T A 9: 70,338,784 L419Q probably damaging Het
Myo6 C A 9: 80,300,572 H1115Q probably damaging Het
Myo7a A G 7: 98,107,095 V10A probably damaging Het
Myoz2 C T 3: 123,026,127 R61H probably damaging Het
Ncdn G A 4: 126,752,003 R38C probably damaging Het
Nckap1 T A 2: 80,520,556 T736S probably benign Het
Ncor2 G A 5: 125,019,890 A2325V probably damaging Het
Nid2 T A 14: 19,752,431 V140E possibly damaging Het
Nlrp9c C A 7: 26,380,490 D704Y probably benign Het
Notch3 T A 17: 32,158,725 S126C probably damaging Het
Olfr1128 A T 2: 87,544,983 L187H probably damaging Het
Olfr130 T C 17: 38,067,948 I259T probably damaging Het
Olfr215 A C 6: 116,582,697 F83C probably damaging Het
Olfr484 A G 7: 108,124,915 F116S probably benign Het
Olfr804 T C 10: 129,705,607 M243T possibly damaging Het
Olfr818 A T 10: 129,945,582 L160* probably null Het
Pdzd7 A G 19: 45,039,228 I269T probably damaging Het
Phf3 A T 1: 30,806,206 D1299E probably damaging Het
Pitx2 T A 3: 129,218,754 Y271N probably damaging Het
Polk T C 13: 96,496,632 E301G probably damaging Het
Prkdc C A 16: 15,739,524 N2230K probably damaging Het
Prlr A G 15: 10,322,536 E170G probably benign Het
Prss55 A G 14: 64,075,730 I235T probably damaging Het
Psd3 T C 8: 67,960,565 I724V probably benign Het
Rabep2 A G 7: 126,438,799 T248A possibly damaging Het
Rbm26 T A 14: 105,117,073 K949N probably benign Het
Rnf213 T A 11: 119,440,221 D2085E probably damaging Het
Serpinb7 A T 1: 107,450,273 H232L possibly damaging Het
Slu7 A G 11: 43,445,242 Q484R probably benign Het
Smg1 A G 7: 118,145,798 S3044P possibly damaging Het
Snrnp48 A G 13: 38,221,360 D248G possibly damaging Het
Snrpc C A 17: 27,845,219 P66Q unknown Het
Snrpn T A 7: 59,983,459 probably benign Het
Spag17 T A 3: 99,939,356 S65R possibly damaging Het
Srsf6 C A 2: 162,934,488 probably benign Het
Stil T A 4: 115,041,782 M1203K probably benign Het
Syt17 T C 7: 118,436,838 T106A probably benign Het
Tbx15 C T 3: 99,352,246 Q478* probably null Het
Tg A T 15: 66,737,548 Q319L probably benign Het
Thada A G 17: 84,448,033 L243P probably damaging Het
Thada G T 17: 84,448,034 L243I probably damaging Het
Tnnt3 A G 7: 142,512,364 R211G probably damaging Het
Togaram1 A T 12: 65,002,635 Q1282L possibly damaging Het
Tpm3-rs7 T G 14: 113,314,947 M91R probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttll7 T G 3: 146,915,780 L378R probably damaging Het
Tyw1 T G 5: 130,258,993 I22R probably damaging Het
Ubr3 T C 2: 70,016,367 S1645P possibly damaging Het
Ubr4 T C 4: 139,393,053 L263P probably damaging Het
Unc13c T C 9: 73,756,339 E1071G possibly damaging Het
Vmn2r44 G T 7: 8,380,123 D157E possibly damaging Het
Vps16 C T 2: 130,443,600 T821I probably benign Het
Washc4 T C 10: 83,579,525 V793A possibly damaging Het
Wdr35 G T 12: 8,977,435 probably null Het
Zfp277 A G 12: 40,364,085 F254L probably benign Het
Other mutations in Col5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00567:Col5a2 APN 1 45392877 splice site probably benign
IGL00978:Col5a2 APN 1 45376739 missense probably benign 0.01
IGL01366:Col5a2 APN 1 45391888 missense possibly damaging 0.46
IGL01487:Col5a2 APN 1 45376739 missense probably benign 0.01
IGL01820:Col5a2 APN 1 45442825 missense unknown
IGL01980:Col5a2 APN 1 45382233 splice site probably benign
IGL02063:Col5a2 APN 1 45403419 critical splice donor site probably null
IGL02134:Col5a2 APN 1 45391070 splice site probably null
IGL02233:Col5a2 APN 1 45383587 splice site probably null
IGL02489:Col5a2 APN 1 45392811 splice site probably null
IGL02928:Col5a2 APN 1 45385020 missense probably benign 0.41
IGL02931:Col5a2 APN 1 45385065 missense probably damaging 1.00
IGL03328:Col5a2 APN 1 45376146 missense possibly damaging 0.94
R0022:Col5a2 UTSW 1 45383683 nonsense probably null
R0123:Col5a2 UTSW 1 45407035 missense probably benign 0.28
R0180:Col5a2 UTSW 1 45411460 missense probably damaging 1.00
R0225:Col5a2 UTSW 1 45407035 missense probably benign 0.28
R0455:Col5a2 UTSW 1 45382102 splice site probably benign
R0485:Col5a2 UTSW 1 45378482 missense probably damaging 0.99
R0702:Col5a2 UTSW 1 45380131 missense possibly damaging 0.54
R0745:Col5a2 UTSW 1 45407227 splice site probably null
R1147:Col5a2 UTSW 1 45376771 missense probably damaging 0.99
R1147:Col5a2 UTSW 1 45376771 missense probably damaging 0.99
R1394:Col5a2 UTSW 1 45403419 critical splice donor site probably null
R1494:Col5a2 UTSW 1 45502914 start codon destroyed unknown
R1499:Col5a2 UTSW 1 45411466 missense probably benign 0.00
R1733:Col5a2 UTSW 1 45407032 missense possibly damaging 0.81
R1789:Col5a2 UTSW 1 45378305 critical splice donor site probably null
R2114:Col5a2 UTSW 1 45376804 missense probably damaging 0.98
R2915:Col5a2 UTSW 1 45413496 missense probably damaging 1.00
R3861:Col5a2 UTSW 1 45380237 missense probably damaging 0.98
R4015:Col5a2 UTSW 1 45403471 missense probably benign 0.14
R4944:Col5a2 UTSW 1 45376695 missense possibly damaging 0.75
R4982:Col5a2 UTSW 1 45389458 missense possibly damaging 0.88
R5001:Col5a2 UTSW 1 45502898 missense unknown
R5159:Col5a2 UTSW 1 45386831 critical splice donor site probably null
R5197:Col5a2 UTSW 1 45393081 missense probably benign 0.01
R5407:Col5a2 UTSW 1 45406280 missense possibly damaging 0.54
R5502:Col5a2 UTSW 1 45380126 missense probably damaging 1.00
R5575:Col5a2 UTSW 1 45378482 missense probably damaging 0.99
R5622:Col5a2 UTSW 1 45427059 missense probably benign
R5643:Col5a2 UTSW 1 45390042 missense probably damaging 1.00
R5801:Col5a2 UTSW 1 45389481 critical splice acceptor site probably null
R6075:Col5a2 UTSW 1 45502848 missense unknown
R6211:Col5a2 UTSW 1 45376666 missense probably damaging 0.99
R6407:Col5a2 UTSW 1 45376778 missense probably damaging 0.99
R6494:Col5a2 UTSW 1 45378327 missense probably damaging 0.99
R6582:Col5a2 UTSW 1 45390115 missense possibly damaging 0.91
R6687:Col5a2 UTSW 1 45383604 missense probably damaging 1.00
R7007:Col5a2 UTSW 1 45378449 missense possibly damaging 0.53
R7062:Col5a2 UTSW 1 45417625 missense probably benign 0.00
R7098:Col5a2 UTSW 1 45380067 missense possibly damaging 0.48
R7243:Col5a2 UTSW 1 45376160 missense probably benign 0.39
R7326:Col5a2 UTSW 1 45442867 missense unknown
R7332:Col5a2 UTSW 1 45380165 missense probably damaging 1.00
X0013:Col5a2 UTSW 1 45403258 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCTGGCTATGCATTTTCTCAAC -3'
(R):5'- GAGATCCCACTCAGACAGTTTC -3'

Sequencing Primer
(F):5'- GCTATGCATTTTCTCAACCAATAAAG -3'
(R):5'- GACAGTTTCCCTAATACACAATCTG -3'
Posted On2014-06-23