Incidental Mutation 'R1789:Fat3'
ID201630
Institutional Source Beutler Lab
Gene Symbol Fat3
Ensembl Gene ENSMUSG00000074505
Gene NameFAT atypical cadherin 3
Synonyms9430076A06Rik, D430038H04Rik, LOC382129, LOC234973
MMRRC Submission 039820-MU
Accession Numbers

Genbank: NM_001080814; MGI: 2444314

Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R1789 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location15910189-16501285 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16376985 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 414 (Y414C)
Ref Sequence ENSEMBL: ENSMUSP00000148968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082170] [ENSMUST00000217308]
Predicted Effect probably benign
Transcript: ENSMUST00000082170
AA Change: Y414C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000080808
Gene: ENSMUSG00000074505
AA Change: Y414C

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 65 151 3e-7 SMART
CA 175 259 8.9e-22 SMART
CA 280 368 8.9e-4 SMART
CA 389 465 2.6e-11 SMART
CA 489 571 2e-29 SMART
low complexity region 684 697 N/A INTRINSIC
CA 743 824 1e-24 SMART
low complexity region 830 840 N/A INTRINSIC
CA 848 929 7.6e-26 SMART
CA 953 1034 1.5e-25 SMART
CA 1060 1141 6.6e-32 SMART
CA 1165 1247 1.5e-30 SMART
CA 1273 1349 1.8e-8 SMART
CA 1375 1453 2.9e-12 SMART
CA 1477 1559 3e-22 SMART
CA 1583 1664 3.1e-16 SMART
CA 1688 1762 4.2e-22 SMART
CA 1793 1876 2.5e-26 SMART
CA 1900 1975 1.5e-8 SMART
low complexity region 1983 1994 N/A INTRINSIC
CA 1999 2077 1.4e-18 SMART
CA 2101 2179 6.6e-10 SMART
CA 2203 2280 4.9e-19 SMART
CA 2304 2387 4.3e-29 SMART
CA 2411 2489 4.2e-11 SMART
CA 2513 2593 2.8e-22 SMART
CA 2617 2701 4.3e-10 SMART
CA 2719 2807 2.5e-7 SMART
CA 2831 2917 3.3e-27 SMART
CA 2941 3022 9.4e-23 SMART
CA 3046 3124 2.4e-26 SMART
CA 3148 3229 1.3e-32 SMART
CA 3253 3334 1.3e-29 SMART
CA 3358 3439 4.9e-28 SMART
CA 3463 3544 6.4e-12 SMART
EGF 3793 3828 1.3e-1 SMART
LamG 3852 3989 4.3e-25 SMART
EGF 4019 4053 2.7e-6 SMART
EGF 4058 4091 4.5e-6 SMART
EGF_CA 4093 4129 3.9e-11 SMART
transmembrane domain 4151 4170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217308
AA Change: Y414C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozgyous for a knock-out allele exhibit abnormal amacrine cell differentiation and migration that result in the formation of two additional plexiform layers and thickened retinal ganglion layer. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,365,951 P986L probably damaging Het
Acad10 A T 5: 121,631,393 Y667N possibly damaging Het
Ahi1 G A 10: 20,963,115 G121D probably benign Het
Ampd1 T A 3: 103,099,126 I690N possibly damaging Het
Amy1 C A 3: 113,558,165 W425L possibly damaging Het
Arhgap27 A T 11: 103,333,005 V823E probably damaging Het
Arhgef17 A G 7: 100,929,870 S624P probably damaging Het
Arid5b T C 10: 68,186,067 H231R probably damaging Het
Aspscr1 C A 11: 120,688,560 T78N probably damaging Het
Auts2 T A 5: 131,472,450 T42S probably damaging Het
Ccdc171 A G 4: 83,554,808 D158G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap61 T C 2: 145,939,993 probably null Het
Chrna5 T C 9: 55,004,651 V245A possibly damaging Het
Cntnap5c G A 17: 58,013,921 G163R probably damaging Het
Col5a2 A G 1: 45,378,305 probably null Het
Col5a2 T C 1: 45,394,776 Q759R probably damaging Het
Comp A G 8: 70,377,146 D340G probably benign Het
Cyfip1 T A 7: 55,926,395 D1104E probably damaging Het
Dnah11 A T 12: 118,038,780 S308T probably damaging Het
Dnah5 A G 15: 28,270,426 H958R probably benign Het
Elp3 A G 14: 65,547,919 Y478H probably damaging Het
Fbxo10 C A 4: 45,046,389 A574S probably damaging Het
Fsip2 G T 2: 82,977,562 L1408F probably benign Het
Fubp3 T C 2: 31,611,735 V425A possibly damaging Het
Gm7168 A T 17: 13,949,584 R404S probably benign Het
Gm8773 A T 5: 5,575,652 Q116L possibly damaging Het
Gpd1 T G 15: 99,723,202 F299C probably damaging Het
Gpr137 C T 19: 6,942,057 probably benign Het
Grin3b T C 10: 79,973,408 S331P probably benign Het
Grk3 T A 5: 112,941,718 I281F probably damaging Het
Hoxb7 T A 11: 96,286,781 S18R probably damaging Het
Igf1r C T 7: 68,214,933 R1160* probably null Het
Itfg1 A G 8: 85,725,512 probably null Het
Itgb8 T C 12: 119,202,455 I114V probably benign Het
Kcnk1 A G 8: 126,025,384 E243G possibly damaging Het
Kif27 A G 13: 58,344,008 L439P probably damaging Het
Kif2c T A 4: 117,167,361 Q279L probably benign Het
Kmt2d A T 15: 98,852,074 probably benign Het
L3mbtl1 A G 2: 162,974,502 T821A probably benign Het
Lrrc24 A T 15: 76,722,578 M206K probably benign Het
Mamdc4 T G 2: 25,567,622 K460Q possibly damaging Het
Maml2 C G 9: 13,697,345 L30V probably damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Myo10 T G 15: 25,726,525 probably null Het
Myo1e T A 9: 70,338,784 L419Q probably damaging Het
Myo6 C A 9: 80,300,572 H1115Q probably damaging Het
Myo7a A G 7: 98,107,095 V10A probably damaging Het
Myoz2 C T 3: 123,026,127 R61H probably damaging Het
Ncdn G A 4: 126,752,003 R38C probably damaging Het
Nckap1 T A 2: 80,520,556 T736S probably benign Het
Ncor2 G A 5: 125,019,890 A2325V probably damaging Het
Nid2 T A 14: 19,752,431 V140E possibly damaging Het
Nlrp9c C A 7: 26,380,490 D704Y probably benign Het
Notch3 T A 17: 32,158,725 S126C probably damaging Het
Olfr1128 A T 2: 87,544,983 L187H probably damaging Het
Olfr130 T C 17: 38,067,948 I259T probably damaging Het
Olfr215 A C 6: 116,582,697 F83C probably damaging Het
Olfr484 A G 7: 108,124,915 F116S probably benign Het
Olfr804 T C 10: 129,705,607 M243T possibly damaging Het
Olfr818 A T 10: 129,945,582 L160* probably null Het
Pdzd7 A G 19: 45,039,228 I269T probably damaging Het
Phf3 A T 1: 30,806,206 D1299E probably damaging Het
Pitx2 T A 3: 129,218,754 Y271N probably damaging Het
Polk T C 13: 96,496,632 E301G probably damaging Het
Prkdc C A 16: 15,739,524 N2230K probably damaging Het
Prlr A G 15: 10,322,536 E170G probably benign Het
Prss55 A G 14: 64,075,730 I235T probably damaging Het
Psd3 T C 8: 67,960,565 I724V probably benign Het
Rabep2 A G 7: 126,438,799 T248A possibly damaging Het
Rbm26 T A 14: 105,117,073 K949N probably benign Het
Rnf213 T A 11: 119,440,221 D2085E probably damaging Het
Serpinb7 A T 1: 107,450,273 H232L possibly damaging Het
Slu7 A G 11: 43,445,242 Q484R probably benign Het
Smg1 A G 7: 118,145,798 S3044P possibly damaging Het
Snrnp48 A G 13: 38,221,360 D248G possibly damaging Het
Snrpc C A 17: 27,845,219 P66Q unknown Het
Snrpn T A 7: 59,983,459 probably benign Het
Spag17 T A 3: 99,939,356 S65R possibly damaging Het
Srsf6 C A 2: 162,934,488 probably benign Het
Stil T A 4: 115,041,782 M1203K probably benign Het
Syt17 T C 7: 118,436,838 T106A probably benign Het
Tbx15 C T 3: 99,352,246 Q478* probably null Het
Tg A T 15: 66,737,548 Q319L probably benign Het
Thada A G 17: 84,448,033 L243P probably damaging Het
Thada G T 17: 84,448,034 L243I probably damaging Het
Tnnt3 A G 7: 142,512,364 R211G probably damaging Het
Togaram1 A T 12: 65,002,635 Q1282L possibly damaging Het
Tpm3-rs7 T G 14: 113,314,947 M91R probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttll7 T G 3: 146,915,780 L378R probably damaging Het
Tyw1 T G 5: 130,258,993 I22R probably damaging Het
Ubr3 T C 2: 70,016,367 S1645P possibly damaging Het
Ubr4 T C 4: 139,393,053 L263P probably damaging Het
Unc13c T C 9: 73,756,339 E1071G possibly damaging Het
Vmn2r44 G T 7: 8,380,123 D157E possibly damaging Het
Vps16 C T 2: 130,443,600 T821I probably benign Het
Washc4 T C 10: 83,579,525 V793A possibly damaging Het
Wdr35 G T 12: 8,977,435 probably null Het
Zfp277 A G 12: 40,364,085 F254L probably benign Het
Other mutations in Fat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Fat3 APN 9 15996427 missense possibly damaging 0.77
IGL00962:Fat3 APN 9 15915519 missense probably benign 0.14
IGL00966:Fat3 APN 9 15999094 missense possibly damaging 0.69
IGL01100:Fat3 APN 9 16375228 missense probably damaging 1.00
IGL01104:Fat3 APN 9 16375728 missense possibly damaging 0.92
IGL01104:Fat3 APN 9 15998460 missense probably damaging 1.00
IGL01121:Fat3 APN 9 15998401 missense probably benign 0.00
IGL01407:Fat3 APN 9 16378023 missense probably benign 0.01
IGL01444:Fat3 APN 9 15998848 missense probably damaging 1.00
IGL01634:Fat3 APN 9 15998358 missense probably damaging 1.00
IGL01649:Fat3 APN 9 16376719 missense possibly damaging 0.95
IGL01839:Fat3 APN 9 15997872 missense probably damaging 1.00
IGL01867:Fat3 APN 9 16377901 missense probably benign 0.03
IGL01894:Fat3 APN 9 16375849 missense probably benign
IGL01913:Fat3 APN 9 15998790 missense probably damaging 0.99
IGL02033:Fat3 APN 9 15915352 missense possibly damaging 0.50
IGL02035:Fat3 APN 9 16377970 missense probably benign 0.06
IGL02146:Fat3 APN 9 15999582 missense probably benign
IGL02147:Fat3 APN 9 15995985 missense probably damaging 1.00
IGL02161:Fat3 APN 9 15997050 missense probably benign 0.10
IGL02161:Fat3 APN 9 15997051 nonsense probably null
IGL02164:Fat3 APN 9 16031424 splice site probably benign
IGL02269:Fat3 APN 9 15915577 missense possibly damaging 0.84
IGL02314:Fat3 APN 9 15969838 missense possibly damaging 0.61
IGL02393:Fat3 APN 9 15988412 nonsense probably null
IGL02410:Fat3 APN 9 15997845 missense probably damaging 1.00
IGL02504:Fat3 APN 9 15959798 missense probably damaging 1.00
IGL02572:Fat3 APN 9 15960506 missense probably benign
IGL02623:Fat3 APN 9 15997137 missense probably damaging 1.00
IGL02654:Fat3 APN 9 15996975 missense possibly damaging 0.84
IGL02749:Fat3 APN 9 16006711 missense possibly damaging 0.93
IGL02810:Fat3 APN 9 16376850 missense probably damaging 1.00
IGL02839:Fat3 APN 9 15919170 missense probably damaging 1.00
IGL02890:Fat3 APN 9 15915340 missense probably benign 0.03
IGL02892:Fat3 APN 9 16377562 missense probably damaging 1.00
IGL03090:Fat3 APN 9 16377239 nonsense probably null
IGL03144:Fat3 APN 9 16375245 missense probably damaging 1.00
IGL03199:Fat3 APN 9 16377048 missense possibly damaging 0.83
IGL03365:Fat3 APN 9 15996469 missense probably damaging 1.00
IGL03392:Fat3 APN 9 16003862 missense probably benign
IGL03408:Fat3 APN 9 15997957 nonsense probably null
gagged UTSW 9 15998271 missense probably damaging 1.00
Muffled UTSW 9 15937991 critical splice donor site probably null
softened UTSW 9 16378185 missense probably benign
F6893:Fat3 UTSW 9 16006789 missense probably damaging 0.99
IGL03050:Fat3 UTSW 9 15996600 missense probably benign 0.04
PIT4142001:Fat3 UTSW 9 15992118 critical splice donor site probably null
PIT4283001:Fat3 UTSW 9 16006601 missense possibly damaging 0.77
PIT4378001:Fat3 UTSW 9 16376808 missense probably benign 0.05
PIT4434001:Fat3 UTSW 9 15996316 missense probably benign 0.00
PIT4468001:Fat3 UTSW 9 15996351 missense probably benign 0.06
R0001:Fat3 UTSW 9 16377873 missense probably damaging 0.99
R0005:Fat3 UTSW 9 15962866 missense probably damaging 1.00
R0005:Fat3 UTSW 9 15962866 missense probably damaging 1.00
R0038:Fat3 UTSW 9 15915010 missense probably damaging 1.00
R0046:Fat3 UTSW 9 15965979 missense possibly damaging 0.65
R0089:Fat3 UTSW 9 15938205 missense probably benign
R0135:Fat3 UTSW 9 16006777 missense probably damaging 1.00
R0255:Fat3 UTSW 9 15969706 splice site probably benign
R0349:Fat3 UTSW 9 16031180 missense probably damaging 1.00
R0361:Fat3 UTSW 9 15998403 missense possibly damaging 0.77
R0382:Fat3 UTSW 9 15959756 missense probably damaging 1.00
R0418:Fat3 UTSW 9 16246896 missense probably damaging 1.00
R0419:Fat3 UTSW 9 15992256 missense probably damaging 1.00
R0437:Fat3 UTSW 9 15996932 missense probably damaging 1.00
R0441:Fat3 UTSW 9 15945008 splice site probably benign
R0480:Fat3 UTSW 9 15997729 missense probably benign 0.00
R0510:Fat3 UTSW 9 15999685 nonsense probably null
R0665:Fat3 UTSW 9 15997402 missense probably benign
R0715:Fat3 UTSW 9 16375123 missense probably benign
R0727:Fat3 UTSW 9 15996699 missense probably damaging 1.00
R0882:Fat3 UTSW 9 16031368 missense possibly damaging 0.84
R0946:Fat3 UTSW 9 15997804 missense possibly damaging 0.95
R1068:Fat3 UTSW 9 15970034 missense probably benign
R1081:Fat3 UTSW 9 16375284 missense possibly damaging 0.62
R1082:Fat3 UTSW 9 16006615 missense probably damaging 1.00
R1148:Fat3 UTSW 9 15996774 missense probably damaging 1.00
R1148:Fat3 UTSW 9 15996774 missense probably damaging 1.00
R1233:Fat3 UTSW 9 15922745 missense probably benign
R1306:Fat3 UTSW 9 16376679 missense probably damaging 1.00
R1311:Fat3 UTSW 9 16021410 missense probably damaging 1.00
R1338:Fat3 UTSW 9 15925091 missense probably benign 0.00
R1395:Fat3 UTSW 9 16246916 missense probably benign 0.00
R1466:Fat3 UTSW 9 16375482 missense probably damaging 0.96
R1466:Fat3 UTSW 9 16375482 missense probably damaging 0.96
R1510:Fat3 UTSW 9 15960055 missense probably damaging 1.00
R1528:Fat3 UTSW 9 15925091 missense probably benign 0.00
R1531:Fat3 UTSW 9 15997465 missense probably damaging 1.00
R1659:Fat3 UTSW 9 15997183 missense possibly damaging 0.91
R1697:Fat3 UTSW 9 15944880 missense probably benign 0.05
R1699:Fat3 UTSW 9 15938398 missense probably damaging 1.00
R1728:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1729:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1731:Fat3 UTSW 9 15995937 missense probably benign
R1784:Fat3 UTSW 9 15996315 missense possibly damaging 0.65
R1794:Fat3 UTSW 9 15997136 nonsense probably null
R1794:Fat3 UTSW 9 15997138 missense probably benign 0.15
R1830:Fat3 UTSW 9 15915340 missense probably benign 0.03
R1835:Fat3 UTSW 9 15998088 missense probably damaging 1.00
R1887:Fat3 UTSW 9 15967061 missense probably damaging 1.00
R1898:Fat3 UTSW 9 15960130 missense probably damaging 1.00
R1909:Fat3 UTSW 9 15998115 missense probably benign
R1912:Fat3 UTSW 9 15969988 missense probably damaging 1.00
R1917:Fat3 UTSW 9 15997057 missense possibly damaging 0.55
R1967:Fat3 UTSW 9 15968295 missense probably benign 0.00
R2070:Fat3 UTSW 9 15999370 missense probably benign 0.21
R2100:Fat3 UTSW 9 16377430 missense possibly damaging 0.73
R2104:Fat3 UTSW 9 15998517 missense possibly damaging 0.77
R2113:Fat3 UTSW 9 15999786 missense probably damaging 1.00
R2132:Fat3 UTSW 9 16246719 critical splice donor site probably null
R2136:Fat3 UTSW 9 16377051 missense probably benign 0.01
R2146:Fat3 UTSW 9 15990512 missense probably benign 0.01
R2233:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2234:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2273:Fat3 UTSW 9 15915262 missense probably benign
R2285:Fat3 UTSW 9 16376173 missense probably damaging 1.00
R2363:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2365:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2367:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2403:Fat3 UTSW 9 15969871 missense probably damaging 1.00
R2447:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R2496:Fat3 UTSW 9 15966103 missense probably benign 0.01
R2509:Fat3 UTSW 9 15925014 missense possibly damaging 0.82
R2932:Fat3 UTSW 9 16375944 missense probably damaging 1.00
R2986:Fat3 UTSW 9 15992128 missense probably damaging 1.00
R3054:Fat3 UTSW 9 15960496 missense probably benign
R3056:Fat3 UTSW 9 15960496 missense probably benign
R3729:Fat3 UTSW 9 16247041 splice site probably benign
R3745:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3806:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3859:Fat3 UTSW 9 15997228 nonsense probably null
R3862:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3890:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3892:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3950:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R3972:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4004:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4005:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4086:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4111:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4113:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4227:Fat3 UTSW 9 16377693 missense probably damaging 1.00
R4352:Fat3 UTSW 9 16246778 missense possibly damaging 0.55
R4394:Fat3 UTSW 9 15922792 missense probably benign 0.11
R4403:Fat3 UTSW 9 15944873 missense probably damaging 1.00
R4433:Fat3 UTSW 9 16031152 missense probably damaging 0.99
R4453:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4479:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4480:Fat3 UTSW 9 15998271 missense probably damaging 1.00
R4521:Fat3 UTSW 9 15922942 missense probably null 0.71
R4620:Fat3 UTSW 9 15996894 missense probably damaging 1.00
R4700:Fat3 UTSW 9 16031173 missense probably damaging 1.00
R4721:Fat3 UTSW 9 16029966 missense probably damaging 1.00
R4790:Fat3 UTSW 9 15998484 missense probably damaging 1.00
R4796:Fat3 UTSW 9 15999732 missense probably benign 0.17
R4823:Fat3 UTSW 9 15996507 missense probably benign
R4836:Fat3 UTSW 9 16377723 missense probably damaging 1.00
R4842:Fat3 UTSW 9 15997587 missense probably damaging 1.00
R4849:Fat3 UTSW 9 16377948 missense probably benign 0.03
R4856:Fat3 UTSW 9 16021330 missense probably benign
R4869:Fat3 UTSW 9 16377477 missense probably damaging 0.98
R4886:Fat3 UTSW 9 16021330 missense probably benign
R4899:Fat3 UTSW 9 15969799 missense probably damaging 1.00
R4941:Fat3 UTSW 9 16375152 missense probably damaging 1.00
R4986:Fat3 UTSW 9 15998340 missense probably damaging 1.00
R5058:Fat3 UTSW 9 15996858 missense probably damaging 1.00
R5079:Fat3 UTSW 9 15999127 missense probably benign 0.01
R5080:Fat3 UTSW 9 15999338 missense probably benign 0.35
R5174:Fat3 UTSW 9 15999570 missense probably damaging 1.00
R5183:Fat3 UTSW 9 15960313 missense probably damaging 0.99
R5203:Fat3 UTSW 9 16378142 missense possibly damaging 0.79
R5216:Fat3 UTSW 9 16377537 missense probably damaging 1.00
R5230:Fat3 UTSW 9 15990560 missense possibly damaging 0.51
R5318:Fat3 UTSW 9 16376629 missense probably damaging 1.00
R5377:Fat3 UTSW 9 16376443 missense probably benign 0.05
R5385:Fat3 UTSW 9 15922675 missense possibly damaging 0.82
R5436:Fat3 UTSW 9 15960514 missense probably benign 0.02
R5437:Fat3 UTSW 9 16085308 missense probably damaging 1.00
R5453:Fat3 UTSW 9 15996864 missense probably damaging 1.00
R5460:Fat3 UTSW 9 15919167 missense probably damaging 1.00
R5516:Fat3 UTSW 9 15998709 missense probably damaging 1.00
R5568:Fat3 UTSW 9 16376923 nonsense probably null
R5628:Fat3 UTSW 9 15966096 missense probably damaging 1.00
R5835:Fat3 UTSW 9 16375833 missense probably damaging 1.00
R5845:Fat3 UTSW 9 16377210 missense probably damaging 1.00
R5898:Fat3 UTSW 9 15938461 missense probably benign 0.15
R5941:Fat3 UTSW 9 15999501 missense probably benign 0.07
R5974:Fat3 UTSW 9 16006528 critical splice donor site probably null
R5986:Fat3 UTSW 9 15998317 missense probably benign 0.22
R6015:Fat3 UTSW 9 16376050 missense possibly damaging 0.55
R6031:Fat3 UTSW 9 15988492 missense probably benign 0.02
R6031:Fat3 UTSW 9 15988492 missense probably benign 0.02
R6042:Fat3 UTSW 9 16377817 missense probably benign 0.12
R6051:Fat3 UTSW 9 16375455 missense possibly damaging 0.83
R6052:Fat3 UTSW 9 15922679 missense probably null
R6119:Fat3 UTSW 9 16376568 missense possibly damaging 0.82
R6161:Fat3 UTSW 9 16377522 missense probably damaging 1.00
R6254:Fat3 UTSW 9 15996145 missense probably benign 0.19
R6318:Fat3 UTSW 9 15916984 intron probably benign
R6347:Fat3 UTSW 9 15998372 missense probably damaging 1.00
R6348:Fat3 UTSW 9 15937991 critical splice donor site probably null
R6351:Fat3 UTSW 9 15938398 missense probably damaging 1.00
R6450:Fat3 UTSW 9 15999170 missense possibly damaging 0.51
R6460:Fat3 UTSW 9 15967000 missense probably damaging 1.00
R6524:Fat3 UTSW 9 15992256 missense probably damaging 1.00
R6533:Fat3 UTSW 9 15998899 missense probably benign 0.02
R6565:Fat3 UTSW 9 15915327 missense probably benign
R6576:Fat3 UTSW 9 16377210 missense probably damaging 1.00
R6649:Fat3 UTSW 9 16376742 missense probably damaging 1.00
R6716:Fat3 UTSW 9 15919269 missense probably benign
R6719:Fat3 UTSW 9 15996144 missense probably benign
R6753:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6754:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6755:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6792:Fat3 UTSW 9 16375644 missense probably damaging 1.00
R6802:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6803:Fat3 UTSW 9 15996787 missense probably damaging 0.99
R6831:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6831:Fat3 UTSW 9 16376551 missense probably damaging 0.98
R6833:Fat3 UTSW 9 15915061 missense possibly damaging 0.82
R6877:Fat3 UTSW 9 15999268 missense probably benign
R6894:Fat3 UTSW 9 15997776 missense probably damaging 1.00
R6915:Fat3 UTSW 9 16377748 missense probably benign 0.37
R6931:Fat3 UTSW 9 15959942 missense possibly damaging 0.89
R6934:Fat3 UTSW 9 16376956 missense probably damaging 0.98
R6940:Fat3 UTSW 9 15916800 intron probably null
R6959:Fat3 UTSW 9 15996885 missense possibly damaging 0.91
R6969:Fat3 UTSW 9 16029916 missense probably benign 0.29
R6986:Fat3 UTSW 9 16021335 missense probably damaging 1.00
R6993:Fat3 UTSW 9 15919221 missense probably damaging 1.00
R7039:Fat3 UTSW 9 16376265 missense probably damaging 1.00
R7051:Fat3 UTSW 9 16377827 missense probably damaging 1.00
R7089:Fat3 UTSW 9 15996918 missense probably benign 0.01
R7136:Fat3 UTSW 9 16378185 missense probably benign
R7137:Fat3 UTSW 9 15997148 missense probably damaging 1.00
R7154:Fat3 UTSW 9 15996864 missense probably damaging 1.00
R7170:Fat3 UTSW 9 16006574 missense probably damaging 0.99
R7183:Fat3 UTSW 9 15922837 missense possibly damaging 0.81
R7237:Fat3 UTSW 9 16377214 missense probably damaging 1.00
R7288:Fat3 UTSW 9 15998592 missense probably damaging 1.00
R7293:Fat3 UTSW 9 15915040 missense
R7293:Fat3 UTSW 9 15915296 missense
R7381:Fat3 UTSW 9 16246987 missense probably damaging 1.00
R7438:Fat3 UTSW 9 15988482 missense probably benign
R7537:Fat3 UTSW 9 15938319 missense not run
R7560:Fat3 UTSW 9 15996842 missense not run
X0021:Fat3 UTSW 9 16029931 missense probably null 0.66
X0026:Fat3 UTSW 9 15996333 missense probably benign
X0064:Fat3 UTSW 9 15919277 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGACACGGTCAGAACATTTG -3'
(R):5'- GTTCACATTGCCAACCCCAG -3'

Sequencing Primer
(F):5'- GGTCAGAACATTTGTACCAACACG -3'
(R):5'- TTGCCAACCCCAGGAGAG -3'
Posted On2014-06-23