Incidental Mutation 'R1789:Tg'
ID201667
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Namethyroglobulin
SynonymsTgn
MMRRC Submission 039820-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R1789 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location66670753-66850721 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66737548 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 319 (Q319L)
Ref Sequence ENSEMBL: ENSMUSP00000126454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000163495] [ENSMUST00000171045]
Predicted Effect probably benign
Transcript: ENSMUST00000065916
AA Change: Q1938L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469
AA Change: Q1938L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163495
SMART Domains Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
TY 14 63 1.21e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169163
Predicted Effect probably benign
Transcript: ENSMUST00000171045
AA Change: Q319L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469
AA Change: Q319L

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172153
SMART Domains Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
Pfam:COesterase 313 849 6e-140 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc5 G A 16: 20,365,951 P986L probably damaging Het
Acad10 A T 5: 121,631,393 Y667N possibly damaging Het
Ahi1 G A 10: 20,963,115 G121D probably benign Het
Ampd1 T A 3: 103,099,126 I690N possibly damaging Het
Amy1 C A 3: 113,558,165 W425L possibly damaging Het
Arhgap27 A T 11: 103,333,005 V823E probably damaging Het
Arhgef17 A G 7: 100,929,870 S624P probably damaging Het
Arid5b T C 10: 68,186,067 H231R probably damaging Het
Aspscr1 C A 11: 120,688,560 T78N probably damaging Het
Auts2 T A 5: 131,472,450 T42S probably damaging Het
Ccdc171 A G 4: 83,554,808 D158G probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cfap61 T C 2: 145,939,993 probably null Het
Chrna5 T C 9: 55,004,651 V245A possibly damaging Het
Cntnap5c G A 17: 58,013,921 G163R probably damaging Het
Col5a2 A G 1: 45,378,305 probably null Het
Col5a2 T C 1: 45,394,776 Q759R probably damaging Het
Comp A G 8: 70,377,146 D340G probably benign Het
Cyfip1 T A 7: 55,926,395 D1104E probably damaging Het
Dnah11 A T 12: 118,038,780 S308T probably damaging Het
Dnah5 A G 15: 28,270,426 H958R probably benign Het
Elp3 A G 14: 65,547,919 Y478H probably damaging Het
Fat3 T C 9: 16,376,985 Y414C probably benign Het
Fbxo10 C A 4: 45,046,389 A574S probably damaging Het
Fsip2 G T 2: 82,977,562 L1408F probably benign Het
Fubp3 T C 2: 31,611,735 V425A possibly damaging Het
Gm7168 A T 17: 13,949,584 R404S probably benign Het
Gm8773 A T 5: 5,575,652 Q116L possibly damaging Het
Gpd1 T G 15: 99,723,202 F299C probably damaging Het
Gpr137 C T 19: 6,942,057 probably benign Het
Grin3b T C 10: 79,973,408 S331P probably benign Het
Grk3 T A 5: 112,941,718 I281F probably damaging Het
Hoxb7 T A 11: 96,286,781 S18R probably damaging Het
Igf1r C T 7: 68,214,933 R1160* probably null Het
Itfg1 A G 8: 85,725,512 probably null Het
Itgb8 T C 12: 119,202,455 I114V probably benign Het
Kcnk1 A G 8: 126,025,384 E243G possibly damaging Het
Kif27 A G 13: 58,344,008 L439P probably damaging Het
Kif2c T A 4: 117,167,361 Q279L probably benign Het
Kmt2d A T 15: 98,852,074 probably benign Het
L3mbtl1 A G 2: 162,974,502 T821A probably benign Het
Lrrc24 A T 15: 76,722,578 M206K probably benign Het
Mamdc4 T G 2: 25,567,622 K460Q possibly damaging Het
Maml2 C G 9: 13,697,345 L30V probably damaging Het
Mc5r C G 18: 68,338,670 probably null Het
Myo10 T G 15: 25,726,525 probably null Het
Myo1e T A 9: 70,338,784 L419Q probably damaging Het
Myo6 C A 9: 80,300,572 H1115Q probably damaging Het
Myo7a A G 7: 98,107,095 V10A probably damaging Het
Myoz2 C T 3: 123,026,127 R61H probably damaging Het
Ncdn G A 4: 126,752,003 R38C probably damaging Het
Nckap1 T A 2: 80,520,556 T736S probably benign Het
Ncor2 G A 5: 125,019,890 A2325V probably damaging Het
Nid2 T A 14: 19,752,431 V140E possibly damaging Het
Nlrp9c C A 7: 26,380,490 D704Y probably benign Het
Notch3 T A 17: 32,158,725 S126C probably damaging Het
Olfr1128 A T 2: 87,544,983 L187H probably damaging Het
Olfr130 T C 17: 38,067,948 I259T probably damaging Het
Olfr215 A C 6: 116,582,697 F83C probably damaging Het
Olfr484 A G 7: 108,124,915 F116S probably benign Het
Olfr804 T C 10: 129,705,607 M243T possibly damaging Het
Olfr818 A T 10: 129,945,582 L160* probably null Het
Pdzd7 A G 19: 45,039,228 I269T probably damaging Het
Phf3 A T 1: 30,806,206 D1299E probably damaging Het
Pitx2 T A 3: 129,218,754 Y271N probably damaging Het
Polk T C 13: 96,496,632 E301G probably damaging Het
Prkdc C A 16: 15,739,524 N2230K probably damaging Het
Prlr A G 15: 10,322,536 E170G probably benign Het
Prss55 A G 14: 64,075,730 I235T probably damaging Het
Psd3 T C 8: 67,960,565 I724V probably benign Het
Rabep2 A G 7: 126,438,799 T248A possibly damaging Het
Rbm26 T A 14: 105,117,073 K949N probably benign Het
Rnf213 T A 11: 119,440,221 D2085E probably damaging Het
Serpinb7 A T 1: 107,450,273 H232L possibly damaging Het
Slu7 A G 11: 43,445,242 Q484R probably benign Het
Smg1 A G 7: 118,145,798 S3044P possibly damaging Het
Snrnp48 A G 13: 38,221,360 D248G possibly damaging Het
Snrpc C A 17: 27,845,219 P66Q unknown Het
Snrpn T A 7: 59,983,459 probably benign Het
Spag17 T A 3: 99,939,356 S65R possibly damaging Het
Srsf6 C A 2: 162,934,488 probably benign Het
Stil T A 4: 115,041,782 M1203K probably benign Het
Syt17 T C 7: 118,436,838 T106A probably benign Het
Tbx15 C T 3: 99,352,246 Q478* probably null Het
Thada A G 17: 84,448,033 L243P probably damaging Het
Thada G T 17: 84,448,034 L243I probably damaging Het
Tnnt3 A G 7: 142,512,364 R211G probably damaging Het
Togaram1 A T 12: 65,002,635 Q1282L possibly damaging Het
Tpm3-rs7 T G 14: 113,314,947 M91R probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttll7 T G 3: 146,915,780 L378R probably damaging Het
Tyw1 T G 5: 130,258,993 I22R probably damaging Het
Ubr3 T C 2: 70,016,367 S1645P possibly damaging Het
Ubr4 T C 4: 139,393,053 L263P probably damaging Het
Unc13c T C 9: 73,756,339 E1071G possibly damaging Het
Vmn2r44 G T 7: 8,380,123 D157E possibly damaging Het
Vps16 C T 2: 130,443,600 T821I probably benign Het
Washc4 T C 10: 83,579,525 V793A possibly damaging Het
Wdr35 G T 12: 8,977,435 probably null Het
Zfp277 A G 12: 40,364,085 F254L probably benign Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66847166 missense probably damaging 1.00
IGL00230:Tg APN 15 66827290 missense probably benign 0.00
IGL00324:Tg APN 15 66693424 missense probably benign
IGL00428:Tg APN 15 66773424 missense probably benign 0.33
IGL00703:Tg APN 15 66696489 missense probably benign 0.34
IGL00808:Tg APN 15 66683813 missense probably damaging 1.00
IGL00833:Tg APN 15 66688801 missense probably benign 0.34
IGL00899:Tg APN 15 66674073 critical splice donor site probably null
IGL00921:Tg APN 15 66764453 missense probably benign 0.28
IGL00975:Tg APN 15 66681882 missense probably benign
IGL01288:Tg APN 15 66736276 missense possibly damaging 0.81
IGL01397:Tg APN 15 66696092 splice site probably benign
IGL01634:Tg APN 15 66729566 missense probably benign 0.34
IGL01646:Tg APN 15 66678087 missense probably damaging 1.00
IGL01704:Tg APN 15 66671351 missense probably damaging 0.98
IGL01958:Tg APN 15 66759486 missense probably benign 0.06
IGL02093:Tg APN 15 66692374 missense possibly damaging 0.83
IGL02113:Tg APN 15 66705330 missense probably benign 0.08
IGL02138:Tg APN 15 66717233 missense probably benign 0.01
IGL02156:Tg APN 15 66705348 missense probably benign 0.19
IGL02169:Tg APN 15 66757943 missense probably benign 0.04
IGL02342:Tg APN 15 66764291 missense probably benign
IGL02434:Tg APN 15 66764342 missense probably damaging 0.97
IGL02506:Tg APN 15 66741594 missense possibly damaging 0.71
IGL02513:Tg APN 15 66705274 missense probably benign
IGL02549:Tg APN 15 66839361 missense probably damaging 1.00
IGL02669:Tg APN 15 66748726 splice site probably benign
IGL02756:Tg APN 15 66734586 missense probably benign
IGL02800:Tg APN 15 66757886 missense probably damaging 1.00
IGL02828:Tg APN 15 66682394 missense probably damaging 1.00
IGL02927:Tg APN 15 66678093 missense probably damaging 1.00
IGL03061:Tg APN 15 66671405 missense probably damaging 1.00
IGL03105:Tg APN 15 66715106 missense probably benign 0.01
IGL03160:Tg APN 15 66839303 nonsense probably null
IGL03242:Tg APN 15 66683798 missense probably damaging 0.99
ito UTSW 15 66766162 nonsense probably null
ito2 UTSW 15 66671396 missense probably damaging 1.00
ito3 UTSW 15 66773474 missense probably damaging 1.00
ito4 UTSW 15 66696520 missense possibly damaging 0.47
Papua UTSW 15 66674050 missense probably damaging 1.00
pipistrella UTSW 15 66696135 missense probably damaging 1.00
samarai UTSW 15 66758006 critical splice donor site probably null
sariba UTSW 15 66694870 missense probably benign 0.01
ticker UTSW 15 66827382 nonsense probably null
IGL03134:Tg UTSW 15 66740718 missense probably damaging 1.00
P0019:Tg UTSW 15 66688863 missense probably benign 0.01
R0121:Tg UTSW 15 66740781 missense probably benign 0.04
R0135:Tg UTSW 15 66694870 missense probably benign 0.01
R0227:Tg UTSW 15 66698446 missense possibly damaging 0.84
R0448:Tg UTSW 15 66764442 missense probably damaging 1.00
R0453:Tg UTSW 15 66828533 missense probably benign 0.09
R0504:Tg UTSW 15 66682404 missense probably damaging 0.97
R0543:Tg UTSW 15 66729597 missense probably benign 0.13
R0638:Tg UTSW 15 66717208 missense probably damaging 0.99
R0639:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0646:Tg UTSW 15 66729626 missense probably damaging 0.99
R0666:Tg UTSW 15 66737521 missense probably benign
R0673:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0689:Tg UTSW 15 66839404 splice site probably benign
R0704:Tg UTSW 15 66757880 missense probably benign 0.02
R0730:Tg UTSW 15 66678789 missense probably damaging 1.00
R0830:Tg UTSW 15 66725144 missense probably damaging 1.00
R0959:Tg UTSW 15 66708010 missense probably damaging 0.98
R1027:Tg UTSW 15 66672409 missense possibly damaging 0.65
R1061:Tg UTSW 15 66698559 missense probably benign 0.09
R1086:Tg UTSW 15 66684062 missense probably benign
R1103:Tg UTSW 15 66719655 missense probably benign 0.45
R1240:Tg UTSW 15 66828548 missense probably benign 0.16
R1281:Tg UTSW 15 66696489 missense probably benign 0.34
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1531:Tg UTSW 15 66850502 missense probably benign 0.02
R1544:Tg UTSW 15 66705232 missense probably benign 0.04
R1550:Tg UTSW 15 66693430 missense possibly damaging 0.52
R1575:Tg UTSW 15 66729685 critical splice donor site probably null
R1638:Tg UTSW 15 66696166 nonsense probably null
R1655:Tg UTSW 15 66828568 critical splice donor site probably null
R1671:Tg UTSW 15 66692387 missense possibly damaging 0.89
R1883:Tg UTSW 15 66671309 missense probably damaging 1.00
R1984:Tg UTSW 15 66682842 missense probably benign
R2063:Tg UTSW 15 66828553 missense probably damaging 1.00
R2092:Tg UTSW 15 66849607 missense probably null 0.26
R2109:Tg UTSW 15 66729594 missense probably benign 0.02
R2128:Tg UTSW 15 66694894 missense probably benign 0.10
R2129:Tg UTSW 15 66694894 missense probably benign 0.10
R2207:Tg UTSW 15 66681939 missense probably benign 0.15
R2219:Tg UTSW 15 66681933 missense probably benign 0.03
R2228:Tg UTSW 15 66674011 missense probably damaging 0.99
R2229:Tg UTSW 15 66674011 missense probably damaging 0.99
R2259:Tg UTSW 15 66683898 missense probably benign
R2994:Tg UTSW 15 66681953 missense probably benign
R3904:Tg UTSW 15 66766162 nonsense probably null
R3946:Tg UTSW 15 66674023 missense probably damaging 1.00
R3965:Tg UTSW 15 66684190 missense probably benign
R4245:Tg UTSW 15 66696469 missense possibly damaging 0.68
R4451:Tg UTSW 15 66766147 missense probably benign 0.01
R4487:Tg UTSW 15 66671396 missense probably damaging 1.00
R4489:Tg UTSW 15 66707942 missense probably damaging 1.00
R4623:Tg UTSW 15 66735271 missense probably benign 0.23
R4659:Tg UTSW 15 66673920 missense possibly damaging 0.67
R4728:Tg UTSW 15 66682827 missense probably damaging 1.00
R4760:Tg UTSW 15 66693319 missense probably damaging 1.00
R4797:Tg UTSW 15 66758006 critical splice donor site probably null
R4944:Tg UTSW 15 66764337 missense probably damaging 1.00
R4998:Tg UTSW 15 66674050 missense probably damaging 1.00
R5009:Tg UTSW 15 66696586 missense probably benign 0.01
R5025:Tg UTSW 15 66707930 missense probably damaging 1.00
R5035:Tg UTSW 15 66681813 splice site probably null
R5049:Tg UTSW 15 66827382 nonsense probably null
R5073:Tg UTSW 15 66735252 missense probably benign 0.05
R5169:Tg UTSW 15 66678780 nonsense probably null
R5185:Tg UTSW 15 66773474 missense probably damaging 1.00
R5227:Tg UTSW 15 66759567 missense possibly damaging 0.87
R5300:Tg UTSW 15 66678855 missense probably damaging 1.00
R5334:Tg UTSW 15 66678055 missense probably damaging 1.00
R5339:Tg UTSW 15 66678093 missense probably damaging 1.00
R5402:Tg UTSW 15 66739168 missense probably damaging 0.98
R5441:Tg UTSW 15 66696520 missense possibly damaging 0.47
R5509:Tg UTSW 15 66827293 missense probably benign 0.45
R5580:Tg UTSW 15 66685300 missense possibly damaging 0.66
R5582:Tg UTSW 15 66693435 missense probably damaging 1.00
R5624:Tg UTSW 15 66838057 missense probably benign 0.11
R5686:Tg UTSW 15 66688889 missense probably benign 0.28
R6042:Tg UTSW 15 66683993 missense probably benign 0.01
R6122:Tg UTSW 15 66828457 missense probably damaging 1.00
R6146:Tg UTSW 15 66673367 splice site probably null
R6159:Tg UTSW 15 66735247 missense possibly damaging 0.71
R6223:Tg UTSW 15 66707922 missense probably benign 0.15
R6480:Tg UTSW 15 66671311 missense probably damaging 1.00
R6505:Tg UTSW 15 66759558 missense probably damaging 0.99
R6531:Tg UTSW 15 66839362 missense probably damaging 0.99
R6614:Tg UTSW 15 66735259 missense probably damaging 0.99
R6698:Tg UTSW 15 66839362 missense probably damaging 1.00
R6798:Tg UTSW 15 66678839 missense probably damaging 1.00
R6837:Tg UTSW 15 66696135 missense probably damaging 1.00
R6861:Tg UTSW 15 66688891 missense probably benign 0.00
R6888:Tg UTSW 15 66696246 missense probably damaging 0.99
R6933:Tg UTSW 15 66764309 missense possibly damaging 0.73
R6983:Tg UTSW 15 66693358 missense probably benign 0.01
R7078:Tg UTSW 15 66673543 missense not run
T0975:Tg UTSW 15 66688863 missense probably benign 0.01
X0005:Tg UTSW 15 66688863 missense probably benign 0.01
X0065:Tg UTSW 15 66682454 missense probably damaging 1.00
X0067:Tg UTSW 15 66748743 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ACCCCAGGCTTGTCATGAAC -3'
(R):5'- TGGCGTCATATCTCTGAAGGAC -3'

Sequencing Primer
(F):5'- GGCTTGTCATGAACTAAACACC -3'
(R):5'- CGTCATATCTCTGAAGGACCATGG -3'
Posted On2014-06-23