Incidental Mutation 'R1791:Thbs2'
ID201780
Institutional Source Beutler Lab
Gene Symbol Thbs2
Ensembl Gene ENSMUSG00000023885
Gene Namethrombospondin 2
SynonymsThbs-2, Thrombospondin-2, TSP2
MMRRC Submission 039821-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R1791 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location14665500-14694235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14685813 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 275 (N275S)
Ref Sequence ENSEMBL: ENSMUSP00000128308 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170872]
Predicted Effect probably benign
Transcript: ENSMUST00000170872
AA Change: N275S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000128308
Gene: ENSMUSG00000023885
AA Change: N275S

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
TSPN 21 215 3.8e-60 SMART
VWC 320 374 3.55e-19 SMART
TSP1 384 431 3.36e-11 SMART
TSP1 440 492 1.35e-15 SMART
TSP1 497 549 8.6e-18 SMART
EGF 552 589 6.3e-3 SMART
EGF 593 647 1.56e1 SMART
EGF 651 692 2.19e-2 SMART
Pfam:TSP_3 729 764 2.5e-12 PFAM
Pfam:TSP_3 763 787 7.4e-7 PFAM
Pfam:TSP_3 788 823 9.4e-12 PFAM
Pfam:TSP_3 823 846 4.1e-7 PFAM
Pfam:TSP_3 847 884 1.7e-12 PFAM
Pfam:TSP_3 885 920 1.3e-11 PFAM
Pfam:TSP_3 921 956 3.1e-11 PFAM
Pfam:TSP_C 974 1171 1e-98 PFAM
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency 95% (104/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. It is a disulfide-linked homotrimeric glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein has been shown to function as a potent inhibitor of tumor growth and angiogenesis. Studies of the mouse counterpart suggest that this protein may modulate the cell surface properties of mesenchymal cells and be involved in cell adhesion and migration. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display premature death, abnormal tails, marked structural and functional abnormalities in a variety of connective tissues including skin, tendon, bone, and blood vessels, accelerated wound healing, and enhanced susceptibility to experimental skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m C A 6: 121,654,612 L623M probably benign Het
Akap13 T G 7: 75,611,035 C333G probably benign Het
Akap6 T C 12: 53,069,125 S1004P probably damaging Het
Akap7 T C 10: 25,239,685 T181A probably benign Het
Ap3b1 A G 13: 94,408,797 E186G possibly damaging Het
Arhgap17 T C 7: 123,286,702 T736A probably benign Het
Bmp8a G T 4: 123,324,585 R214S possibly damaging Het
Cacna1f T C X: 7,620,439 S890P probably damaging Het
Cd96 A T 16: 46,117,999 Y34* probably null Het
Cdc42ep4 A G 11: 113,729,337 L76P probably damaging Het
Cdh23 A G 10: 60,391,726 V1195A possibly damaging Het
Cfap57 G A 4: 118,571,724 T1015M possibly damaging Het
Chrm3 C A 13: 9,877,416 G528V probably damaging Het
Clip4 T C 17: 71,801,942 probably benign Het
Col9a1 A T 1: 24,185,305 R189S unknown Het
Cul4b A T X: 38,547,851 I481N probably damaging Het
Cyp26b1 A G 6: 84,584,459 S74P probably benign Het
Cyp3a57 A G 5: 145,371,010 N192S probably benign Het
Dcbld1 A G 10: 52,319,476 D260G probably damaging Het
Dhrs7 T C 12: 72,653,165 N231S probably benign Het
Disp3 G A 4: 148,241,518 P1261L probably damaging Het
Dyx1c1 T C 9: 72,960,684 Y76H possibly damaging Het
Eml5 C A 12: 98,887,056 V95F probably benign Het
Emsy A G 7: 98,647,880 I32T probably damaging Het
Esr1 A G 10: 4,783,913 R238G probably damaging Het
Exosc1 T C 19: 41,928,085 K84R probably benign Het
F830016B08Rik T A 18: 60,300,517 V224E probably benign Het
Fam228a T A 12: 4,732,748 N115I probably damaging Het
Farp1 T C 14: 121,256,745 I546T probably damaging Het
Fbxo30 T A 10: 11,289,787 C84* probably null Het
Fbxw17 A G 13: 50,425,774 probably benign Het
Foxo4 G C X: 101,258,463 R192P probably benign Het
Galnt7 G T 8: 57,542,530 T377K probably benign Het
Garnl3 T C 2: 33,034,127 I248V probably benign Het
Glod4 A G 11: 76,237,708 Y104H probably damaging Het
Glrb T C 3: 80,860,175 Y246C probably damaging Het
Gm5292 A G 5: 43,944,410 noncoding transcript Het
Gm5424 C A 10: 62,072,307 noncoding transcript Het
Gm7276 C T 18: 77,185,735 probably benign Het
Gm9774 T A 3: 92,428,231 D388V probably damaging Het
Golga5 A G 12: 102,492,131 N611S possibly damaging Het
Gucy2c A C 6: 136,744,027 Y391D probably damaging Het
H6pd A G 4: 149,981,673 I760T probably damaging Het
Hapln2 T A 3: 88,024,405 I5F possibly damaging Het
Hdac11 G T 6: 91,168,824 V169L probably benign Het
Hectd2 T C 19: 36,609,416 V557A possibly damaging Het
Huwe1 T A X: 151,864,753 N747K probably benign Het
Ints1 A G 5: 139,774,522 S66P probably benign Het
Ipo7 A G 7: 110,027,132 D49G probably damaging Het
Itgb4 G A 11: 115,988,520 C575Y probably damaging Het
Klhl3 A G 13: 58,033,230 V250A possibly damaging Het
Klk1b24 A G 7: 44,190,428 probably null Het
Map3k11 T A 19: 5,695,572 Y333* probably null Het
Mbp A G 18: 82,554,349 T57A probably benign Het
Myh9 A G 15: 77,773,264 probably benign Het
Mypn C T 10: 63,125,693 R1040Q probably damaging Het
Ncdn A G 4: 126,751,939 probably null Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Odf3l1 A T 9: 56,851,743 F43I possibly damaging Het
Olfr509 T A 7: 108,646,364 T71S probably benign Het
Olfr566 G A 7: 102,856,362 Q307* probably null Het
Olfr623 T C 7: 103,660,798 probably null Het
Olfr726 A G 14: 50,084,042 F213S probably benign Het
Olfr749 AGGGATTGGG AGGGATTGGGATTGGG 14: 50,736,687 probably benign Het
Olfr924 T A 9: 38,848,605 S164T possibly damaging Het
Pbx3 T C 2: 34,224,452 T82A possibly damaging Het
Pi15 T C 1: 17,602,721 F48S probably benign Het
Pkhd1 A G 1: 20,585,152 probably benign Het
Ppard C G 17: 28,286,374 R12G unknown Het
Prrc2c G T 1: 162,704,982 probably benign Het
Prune1 A G 3: 95,268,242 Y41H possibly damaging Het
Rcsd1 T C 1: 165,655,972 D150G probably damaging Het
Rgs12 A T 5: 34,966,112 Q413L possibly damaging Het
Rhox2h A G X: 37,669,195 Y185H probably damaging Het
Rnf17 T A 14: 56,504,007 C1306* probably null Het
Ros1 T A 10: 52,100,087 M1499L probably benign Het
Rubcnl T C 14: 75,047,549 S503P probably damaging Het
Sap18b A T 8: 95,825,714 R117S probably benign Het
Shank2 A G 7: 144,410,599 E858G probably damaging Het
Shtn1 T C 19: 59,032,200 R197G probably damaging Het
Slamf8 G A 1: 172,584,520 R163* probably null Het
Slc6a3 T C 13: 73,566,292 I392T possibly damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Sp8 T C 12: 118,849,016 V202A possibly damaging Het
Spata13 T C 14: 60,709,459 V652A probably damaging Het
Stpg2 A T 3: 139,317,401 T393S probably benign Het
Tagap T C 17: 7,931,467 M228T probably damaging Het
Tagap A G 17: 7,933,545 T521A probably benign Het
Tas2r123 T G 6: 132,847,565 S142A probably damaging Het
Tat T A 8: 109,991,629 S49T probably benign Het
Tfap4 G T 16: 4,552,069 Q41K possibly damaging Het
Tnfsf14 T A 17: 57,190,867 R122W probably damaging Het
Tnrc6a T C 7: 123,192,917 V1886A possibly damaging Het
Trim56 G A 5: 137,114,398 A88V probably damaging Het
Trio A G 15: 27,841,756 Y1081H probably damaging Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Ube2o G A 11: 116,541,494 T882I probably benign Het
Uhrf1bp1 T A 17: 27,894,746 D1297E probably damaging Het
Upk3a A G 15: 85,020,614 T188A possibly damaging Het
Vmn1r79 A C 7: 12,176,431 D80A probably damaging Het
Wls C A 3: 159,911,813 T375K probably benign Het
Wnt5a T C 14: 28,511,878 M1T probably null Het
Zcchc4 A G 5: 52,796,590 E204G probably damaging Het
Zfp513 G A 5: 31,200,334 P232S possibly damaging Het
Other mutations in Thbs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Thbs2 APN 17 14668835 missense probably damaging 1.00
IGL00764:Thbs2 APN 17 14690252 missense probably damaging 0.98
IGL01370:Thbs2 APN 17 14690065 missense possibly damaging 0.82
IGL01604:Thbs2 APN 17 14678769 missense probably benign 0.31
IGL01936:Thbs2 APN 17 14687814 missense probably benign 0.00
IGL02061:Thbs2 APN 17 14679914 missense probably benign 0.35
IGL02255:Thbs2 APN 17 14689785 missense probably benign 0.00
IGL02342:Thbs2 APN 17 14676316 missense probably damaging 1.00
IGL02402:Thbs2 APN 17 14671454 missense probably benign 0.01
IGL02499:Thbs2 APN 17 14684066 splice site probably benign
IGL02572:Thbs2 APN 17 14677013 missense possibly damaging 0.72
IGL02701:Thbs2 APN 17 14683361 missense probably benign 0.05
IGL02871:Thbs2 APN 17 14685786 missense probably benign
IGL03058:Thbs2 APN 17 14689969 missense possibly damaging 0.91
IGL03185:Thbs2 APN 17 14681410 nonsense probably null
IGL03232:Thbs2 APN 17 14691413 start codon destroyed probably null
IGL03289:Thbs2 APN 17 14690122 missense probably benign 0.00
IGL03407:Thbs2 APN 17 14673273 missense probably benign 0.00
H8562:Thbs2 UTSW 17 14671453 missense probably benign 0.00
IGL02802:Thbs2 UTSW 17 14684127 missense probably benign 0.01
PIT4354001:Thbs2 UTSW 17 14689968 missense probably damaging 0.99
R0088:Thbs2 UTSW 17 14681701 missense possibly damaging 0.96
R0167:Thbs2 UTSW 17 14667525 splice site probably benign
R0415:Thbs2 UTSW 17 14679973 missense probably benign
R0658:Thbs2 UTSW 17 14680325 missense probably benign 0.00
R0735:Thbs2 UTSW 17 14679815 missense probably benign 0.00
R1582:Thbs2 UTSW 17 14671288 missense probably damaging 1.00
R1585:Thbs2 UTSW 17 14689768 missense probably benign 0.00
R1608:Thbs2 UTSW 17 14685781 missense probably benign
R1721:Thbs2 UTSW 17 14678810 missense probably benign 0.00
R1724:Thbs2 UTSW 17 14685900 missense possibly damaging 0.80
R1816:Thbs2 UTSW 17 14670713 missense probably benign 0.01
R1816:Thbs2 UTSW 17 14670714 missense probably benign 0.00
R1911:Thbs2 UTSW 17 14689842 missense probably benign 0.38
R2137:Thbs2 UTSW 17 14673306 missense probably damaging 1.00
R2152:Thbs2 UTSW 17 14673209 missense probably damaging 1.00
R2244:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R2325:Thbs2 UTSW 17 14690289 splice site probably null
R2509:Thbs2 UTSW 17 14685843 missense probably benign 0.11
R3838:Thbs2 UTSW 17 14687851 missense probably benign
R4173:Thbs2 UTSW 17 14681631 intron probably null
R4427:Thbs2 UTSW 17 14680335 missense probably benign
R4495:Thbs2 UTSW 17 14671413 missense probably damaging 1.00
R4789:Thbs2 UTSW 17 14671488 missense probably damaging 1.00
R4928:Thbs2 UTSW 17 14678900 missense probably damaging 1.00
R5058:Thbs2 UTSW 17 14676329 missense probably damaging 1.00
R5112:Thbs2 UTSW 17 14670590 splice site probably null
R5619:Thbs2 UTSW 17 14681244 missense probably damaging 1.00
R5649:Thbs2 UTSW 17 14689953 missense probably damaging 1.00
R5664:Thbs2 UTSW 17 14689837 missense probably damaging 1.00
R5801:Thbs2 UTSW 17 14687863 missense probably damaging 1.00
R5816:Thbs2 UTSW 17 14684071 critical splice donor site probably null
R5840:Thbs2 UTSW 17 14681430 splice site probably null
R6149:Thbs2 UTSW 17 14679680 critical splice donor site probably null
R6166:Thbs2 UTSW 17 14680388 missense probably damaging 1.00
R6412:Thbs2 UTSW 17 14677077 missense probably damaging 1.00
R6473:Thbs2 UTSW 17 14685796 missense probably benign 0.23
R6640:Thbs2 UTSW 17 14673368 missense possibly damaging 0.94
R6695:Thbs2 UTSW 17 14674164 missense possibly damaging 0.54
R6711:Thbs2 UTSW 17 14690265 missense probably benign 0.00
R6947:Thbs2 UTSW 17 14689767 missense possibly damaging 0.79
R6962:Thbs2 UTSW 17 14681820 missense probably benign 0.00
R7183:Thbs2 UTSW 17 14690116 missense possibly damaging 0.90
R7203:Thbs2 UTSW 17 14671458 missense probably damaging 1.00
S24628:Thbs2 UTSW 17 14679973 missense probably benign
X0025:Thbs2 UTSW 17 14681800 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGAAGTATTGGTCCCCAGAGG -3'
(R):5'- CCAGCTTACAGTTGCAAGC -3'

Sequencing Primer
(F):5'- TCCCCAGAGGCCTGACTG -3'
(R):5'- GCTTACAGTTGCAAGCCTGAC -3'
Posted On2014-06-23