Incidental Mutation 'R1792:Gbp10'
ID201813
Institutional Source Beutler Lab
Gene Symbol Gbp10
Ensembl Gene ENSMUSG00000105096
Gene Nameguanylate-binding protein 10
Synonyms
MMRRC Submission 039822-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R1792 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location105215699-105239533 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105224300 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 198 (L198Q)
Ref Sequence ENSEMBL: ENSMUSP00000069042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050011] [ENSMUST00000065588]
Predicted Effect probably benign
Transcript: ENSMUST00000050011
SMART Domains Protein: ENSMUSP00000062528
Gene: ENSMUSG00000079362

DomainStartEndE-ValueType
Pfam:GBP 16 279 7.6e-118 PFAM
Pfam:GBP_C 281 575 2.1e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000065588
AA Change: L198Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069042
Gene: ENSMUSG00000105096
AA Change: L198Q

DomainStartEndE-ValueType
Pfam:GBP 16 279 5e-115 PFAM
Pfam:GBP_C 281 575 3.6e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196634
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 C T 11: 110,184,044 V1398I probably benign Het
Ackr3 A T 1: 90,214,898 N360Y probably benign Het
Acr T G 15: 89,573,143 M198R probably benign Het
Adamts14 A T 10: 61,218,498 M585K probably benign Het
Adgrb3 A T 1: 25,228,471 C853S probably damaging Het
Arhgef28 G T 13: 97,931,186 S1410R probably benign Het
Armc4 T C 18: 7,286,743 T163A probably benign Het
Asprv1 T A 6: 86,628,372 F67I possibly damaging Het
Atp8b4 T A 2: 126,325,294 Y1095F probably benign Het
Cadps A G 14: 12,449,802 S1136P possibly damaging Het
Ccdc36 A C 9: 108,404,912 S526A possibly damaging Het
Ccdc57 T C 11: 120,897,881 Q380R possibly damaging Het
Cdc45 A T 16: 18,807,340 D142E probably benign Het
Cs A T 10: 128,360,079 N386Y possibly damaging Het
Dsc3 A T 18: 19,986,998 V201E probably damaging Het
Dusp26 G T 8: 31,091,935 R19L probably benign Het
Esyt3 C A 9: 99,358,116 E92* probably null Het
Ext2 T C 2: 93,704,545 N625D probably damaging Het
Fam208b T C 13: 3,590,559 K193E possibly damaging Het
Flvcr2 A T 12: 85,747,155 K102* probably null Het
Fmnl2 T A 2: 53,042,317 S103T possibly damaging Het
Fmo4 T A 1: 162,794,290 I451F probably benign Het
Gak A T 5: 108,585,531 Y47* probably null Het
Gm11559 T A 11: 99,864,929 S135T unknown Het
Gm14496 A T 2: 181,996,153 D340V probably benign Het
Grin2a T C 16: 9,992,395 T47A possibly damaging Het
Gtf2ird1 A T 5: 134,366,936 probably null Het
Herc4 T A 10: 63,245,901 M1K probably null Het
Hirip3 T A 7: 126,862,620 V29E probably damaging Het
Hs3st5 A G 10: 36,832,724 D85G probably benign Het
Htt T A 5: 34,907,199 S2981T probably damaging Het
Il20ra G A 10: 19,759,636 V542I probably damaging Het
Itgb2l C A 16: 96,425,082 C603F probably damaging Het
Klhl41 A C 2: 69,670,802 K202N probably benign Het
Lct G A 1: 128,327,942 S121F possibly damaging Het
Lhx6 C T 2: 36,087,375 G355D probably damaging Het
Limk2 A G 11: 3,358,236 V121A probably benign Het
Med1 T G 11: 98,157,283 K896Q probably damaging Het
Muc6 A G 7: 141,634,458 F2789S probably benign Het
Nemf T A 12: 69,312,569 Y997F probably damaging Het
Nrap A G 19: 56,379,158 S296P probably benign Het
Nrxn1 T C 17: 90,588,824 N961D probably damaging Het
Olfr220 T C 1: 174,448,737 V38A probably benign Het
Olfr398 A C 11: 73,983,847 S254A probably benign Het
Olfr777 A T 10: 129,269,243 F27I probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdk4 T A 6: 5,489,166 H247L probably damaging Het
Pkd1l3 T A 8: 109,632,605 V866E probably damaging Het
Pla2g4e G A 2: 120,168,474 P803L probably damaging Het
Pnisr T C 4: 21,860,968 V217A possibly damaging Het
Pole4 G A 6: 82,652,739 P34L unknown Het
Pole4 G T 6: 82,652,740 P34T unknown Het
Ptchd3 G A 11: 121,841,551 W422* probably null Het
Rab1b C T 19: 5,100,485 A167T probably benign Het
Rasal1 T C 5: 120,664,756 M359T probably benign Het
Rexo4 T C 2: 26,960,236 N310D probably benign Het
Rgma C T 7: 73,417,837 T280M probably damaging Het
Rnaset2a A T 17: 8,145,576 I43N probably damaging Het
Rtcb A T 10: 85,942,582 V399E probably damaging Het
Scd4 T G 19: 44,337,574 Y122* probably null Het
Sirt6 T C 10: 81,626,521 I15V possibly damaging Het
Slamf8 A T 1: 172,587,959 V104E possibly damaging Het
Slc12a4 A G 8: 105,951,843 I285T possibly damaging Het
Slc25a13 G A 6: 6,115,104 A207V possibly damaging Het
Slc6a21 T C 7: 45,280,731 S185P probably benign Het
Smarcc2 A C 10: 128,463,871 N135T probably damaging Het
Susd6 T C 12: 80,874,291 S221P probably damaging Het
Syne1 C T 10: 5,040,975 G8418D probably damaging Het
Tbc1d7 C T 13: 43,165,377 V95I probably benign Het
Tcerg1l T C 7: 138,361,866 D225G probably benign Het
Tfip11 A T 5: 112,329,397 I82F possibly damaging Het
Tmem41a C T 16: 21,936,981 G192S probably null Het
Trrap G A 5: 144,853,586 A3619T possibly damaging Het
Tspoap1 G A 11: 87,765,881 probably null Het
Wfdc21 T C 11: 83,747,057 S11P probably benign Het
Zc2hc1b A T 10: 13,168,730 V63E probably damaging Het
Other mutations in Gbp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01470:Gbp10 APN 5 105221114 splice site probably benign
IGL01680:Gbp10 APN 5 105224271 splice site probably null
IGL01809:Gbp10 APN 5 105217359 missense probably benign
IGL01845:Gbp10 APN 5 105219949 splice site probably null
IGL02011:Gbp10 APN 5 105221101 missense probably damaging 1.00
IGL02063:Gbp10 APN 5 105236040 missense possibly damaging 0.95
IGL02533:Gbp10 APN 5 105220035 missense probably damaging 1.00
IGL02612:Gbp10 APN 5 105218502 missense possibly damaging 0.88
R0349:Gbp10 UTSW 5 105221076 missense possibly damaging 0.60
R0462:Gbp10 UTSW 5 105218524 missense possibly damaging 0.67
R0535:Gbp10 UTSW 5 105221011 missense possibly damaging 0.95
R1223:Gbp10 UTSW 5 105219001 missense probably damaging 1.00
R1704:Gbp10 UTSW 5 105224351 missense probably damaging 1.00
R3738:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R3739:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R4035:Gbp10 UTSW 5 105224458 missense possibly damaging 0.84
R4421:Gbp10 UTSW 5 105224651 splice site probably null
R5207:Gbp10 UTSW 5 105224709 missense probably benign 0.05
R5338:Gbp10 UTSW 5 105224300 missense probably damaging 1.00
R6010:Gbp10 UTSW 5 105224339 missense probably damaging 1.00
R6045:Gbp10 UTSW 5 105218403 missense probably damaging 0.98
R6156:Gbp10 UTSW 5 105236149 start gained probably benign
R6285:Gbp10 UTSW 5 105218460 missense probably damaging 1.00
R6525:Gbp10 UTSW 5 105236084 missense probably benign 0.01
R6908:Gbp10 UTSW 5 105221032 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CACCTTGAATAACTTTGCTGTGC -3'
(R):5'- AGCCAAGTGCCAGTTATGTC -3'

Sequencing Primer
(F):5'- AATAACTTTGCTGTGCTTTGGGCTC -3'
(R):5'- GTGCCAGTTATGTCACAGAACTC -3'
Posted On2014-06-23