Incidental Mutation 'R1792:Acr'
ID201869
Institutional Source Beutler Lab
Gene Symbol Acr
Ensembl Gene ENSMUSG00000022622
Gene Nameacrosin prepropeptide
Synonymspreproacrosin
MMRRC Submission 039822-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R1792 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89568326-89574585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 89573143 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 198 (M198R)
Ref Sequence ENSEMBL: ENSMUSP00000023295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023295]
Predicted Effect probably benign
Transcript: ENSMUST00000023295
AA Change: M198R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000023295
Gene: ENSMUSG00000022622
AA Change: M198R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Tryp_SPc 42 286 6.84e-91 SMART
low complexity region 300 311 N/A INTRINSIC
low complexity region 329 364 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000230538
AA Change: M150R
Predicted Effect unknown
Transcript: ENSMUST00000230978
AA Change: M161R
Predicted Effect probably benign
Transcript: ENSMUST00000231216
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acrosin is the major proteinase present in the acrosome of mature spermatozoa. It is a typical serine proteinase with trypsin-like specificity. It is stored in the acrosome in its precursor form, proacrosin. The active enzyme functions in the lysis of the zona pellucida, thus facilitating penetration of the sperm through the innermost glycoprotein layers of the ovum. The mRNA for proacrosin is synthesized only in the postmeiotic stages of spermatogenesis. In humans proacrosin first appears in the haploid spermatids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Males homozygous for a targeted null mutation produce sperm that shows delayed fertilization in vitro. Sperm from mutant gonial cells are ineffective at fertilization in competition with normal sperm both in vitro and in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 C T 11: 110,184,044 V1398I probably benign Het
Ackr3 A T 1: 90,214,898 N360Y probably benign Het
Adamts14 A T 10: 61,218,498 M585K probably benign Het
Adgrb3 A T 1: 25,228,471 C853S probably damaging Het
Arhgef28 G T 13: 97,931,186 S1410R probably benign Het
Armc4 T C 18: 7,286,743 T163A probably benign Het
Asprv1 T A 6: 86,628,372 F67I possibly damaging Het
Atp8b4 T A 2: 126,325,294 Y1095F probably benign Het
Cadps A G 14: 12,449,802 S1136P possibly damaging Het
Ccdc36 A C 9: 108,404,912 S526A possibly damaging Het
Ccdc57 T C 11: 120,897,881 Q380R possibly damaging Het
Cdc45 A T 16: 18,807,340 D142E probably benign Het
Cs A T 10: 128,360,079 N386Y possibly damaging Het
Dsc3 A T 18: 19,986,998 V201E probably damaging Het
Dusp26 G T 8: 31,091,935 R19L probably benign Het
Esyt3 C A 9: 99,358,116 E92* probably null Het
Ext2 T C 2: 93,704,545 N625D probably damaging Het
Fam208b T C 13: 3,590,559 K193E possibly damaging Het
Flvcr2 A T 12: 85,747,155 K102* probably null Het
Fmnl2 T A 2: 53,042,317 S103T possibly damaging Het
Fmo4 T A 1: 162,794,290 I451F probably benign Het
Gak A T 5: 108,585,531 Y47* probably null Het
Gbp10 A T 5: 105,224,300 L198Q probably damaging Het
Gm11559 T A 11: 99,864,929 S135T unknown Het
Gm14496 A T 2: 181,996,153 D340V probably benign Het
Grin2a T C 16: 9,992,395 T47A possibly damaging Het
Gtf2ird1 A T 5: 134,366,936 probably null Het
Herc4 T A 10: 63,245,901 M1K probably null Het
Hirip3 T A 7: 126,862,620 V29E probably damaging Het
Hs3st5 A G 10: 36,832,724 D85G probably benign Het
Htt T A 5: 34,907,199 S2981T probably damaging Het
Il20ra G A 10: 19,759,636 V542I probably damaging Het
Itgb2l C A 16: 96,425,082 C603F probably damaging Het
Klhl41 A C 2: 69,670,802 K202N probably benign Het
Lct G A 1: 128,327,942 S121F possibly damaging Het
Lhx6 C T 2: 36,087,375 G355D probably damaging Het
Limk2 A G 11: 3,358,236 V121A probably benign Het
Med1 T G 11: 98,157,283 K896Q probably damaging Het
Muc6 A G 7: 141,634,458 F2789S probably benign Het
Nemf T A 12: 69,312,569 Y997F probably damaging Het
Nrap A G 19: 56,379,158 S296P probably benign Het
Nrxn1 T C 17: 90,588,824 N961D probably damaging Het
Olfr220 T C 1: 174,448,737 V38A probably benign Het
Olfr398 A C 11: 73,983,847 S254A probably benign Het
Olfr777 A T 10: 129,269,243 F27I probably benign Het
Parp14 G A 16: 35,856,760 A946V probably benign Het
Pdk4 T A 6: 5,489,166 H247L probably damaging Het
Pkd1l3 T A 8: 109,632,605 V866E probably damaging Het
Pla2g4e G A 2: 120,168,474 P803L probably damaging Het
Pnisr T C 4: 21,860,968 V217A possibly damaging Het
Pole4 G A 6: 82,652,739 P34L unknown Het
Pole4 G T 6: 82,652,740 P34T unknown Het
Ptchd3 G A 11: 121,841,551 W422* probably null Het
Rab1b C T 19: 5,100,485 A167T probably benign Het
Rasal1 T C 5: 120,664,756 M359T probably benign Het
Rexo4 T C 2: 26,960,236 N310D probably benign Het
Rgma C T 7: 73,417,837 T280M probably damaging Het
Rnaset2a A T 17: 8,145,576 I43N probably damaging Het
Rtcb A T 10: 85,942,582 V399E probably damaging Het
Scd4 T G 19: 44,337,574 Y122* probably null Het
Sirt6 T C 10: 81,626,521 I15V possibly damaging Het
Slamf8 A T 1: 172,587,959 V104E possibly damaging Het
Slc12a4 A G 8: 105,951,843 I285T possibly damaging Het
Slc25a13 G A 6: 6,115,104 A207V possibly damaging Het
Slc6a21 T C 7: 45,280,731 S185P probably benign Het
Smarcc2 A C 10: 128,463,871 N135T probably damaging Het
Susd6 T C 12: 80,874,291 S221P probably damaging Het
Syne1 C T 10: 5,040,975 G8418D probably damaging Het
Tbc1d7 C T 13: 43,165,377 V95I probably benign Het
Tcerg1l T C 7: 138,361,866 D225G probably benign Het
Tfip11 A T 5: 112,329,397 I82F possibly damaging Het
Tmem41a C T 16: 21,936,981 G192S probably null Het
Trrap G A 5: 144,853,586 A3619T possibly damaging Het
Tspoap1 G A 11: 87,765,881 probably null Het
Wfdc21 T C 11: 83,747,057 S11P probably benign Het
Zc2hc1b A T 10: 13,168,730 V63E probably damaging Het
Other mutations in Acr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Acr APN 15 89573250 missense probably benign 0.19
IGL00857:Acr APN 15 89570002 missense probably benign 0.00
IGL01353:Acr APN 15 89569492 missense probably damaging 1.00
IGL01466:Acr APN 15 89573994 missense probably benign
IGL01599:Acr APN 15 89568414 missense probably benign 0.01
IGL02408:Acr APN 15 89570014 missense probably damaging 1.00
R0042:Acr UTSW 15 89574332 missense probably benign
R0398:Acr UTSW 15 89573941 missense probably damaging 1.00
R0520:Acr UTSW 15 89573227 missense probably damaging 1.00
R0578:Acr UTSW 15 89569475 missense probably damaging 1.00
R0579:Acr UTSW 15 89569475 missense probably damaging 1.00
R1167:Acr UTSW 15 89573974 missense probably damaging 1.00
R2006:Acr UTSW 15 89574201 missense probably benign 0.00
R5531:Acr UTSW 15 89573943 missense probably damaging 1.00
R5577:Acr UTSW 15 89574238 missense probably benign 0.01
R7033:Acr UTSW 15 89569500 missense probably benign 0.03
R7206:Acr UTSW 15 89574171 missense probably benign
R7484:Acr UTSW 15 89573224 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGATAGACGCCATCTCTTCCTC -3'
(R):5'- TAAGATGAGCTCTCAGGGGC -3'

Sequencing Primer
(F):5'- ATCTCTTCCTCCAGGCAAAATTC -3'
(R):5'- ATGAGCTCTCAGGGGCTAGGATC -3'
Posted On2014-06-23