Incidental Mutation 'R0091:Olfr1280'
ID20190
Institutional Source Beutler Lab
Gene Symbol Olfr1280
Ensembl Gene ENSMUSG00000109449
Gene Nameolfactory receptor 1280
SynonymsMOR248-1, GA_x6K02T2Q125-72366920-72367837
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R0091 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location111314017-111326003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111316173 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 231 (D231E)
Ref Sequence ENSEMBL: ENSMUSP00000151980 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082167] [ENSMUST00000090328] [ENSMUST00000204064] [ENSMUST00000213551] [ENSMUST00000219291]
Predicted Effect probably benign
Transcript: ENSMUST00000082167
AA Change: D231E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000080805
Gene: ENSMUSG00000109449
AA Change: D231E

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 3.8e-50 PFAM
Pfam:7tm_1 41 287 9.9e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090328
AA Change: D231E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000087800
Gene: ENSMUSG00000109322
AA Change: D231E

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 3.6e-49 PFAM
Pfam:7tm_1 41 287 3.9e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204064
AA Change: D231E
SMART Domains Protein: ENSMUSP00000145495
Gene: ENSMUSG00000109322
AA Change: D231E

DomainStartEndE-ValueType
Pfam:7tm_4 30 298 2.1e-39 PFAM
Pfam:7tm_1 40 286 7.8e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213551
AA Change: D231E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000219291
AA Change: D231E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.32 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syk A G 13: 52,640,733 Y478C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Olfr1280
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Olfr1280 APN 2 111315670 missense probably damaging 1.00
IGL01906:Olfr1280 APN 2 111315901 missense probably damaging 1.00
R0078:Olfr1280 UTSW 2 111315904 missense probably benign 0.04
R0295:Olfr1280 UTSW 2 111316154 missense probably damaging 0.99
R1650:Olfr1280 UTSW 2 111316295 missense probably benign 0.04
R1808:Olfr1280 UTSW 2 111315998 missense probably benign 0.00
R2120:Olfr1280 UTSW 2 111315499 missense probably benign 0.02
R3084:Olfr1280 UTSW 2 111316116 missense probably benign 0.36
R3085:Olfr1280 UTSW 2 111316116 missense probably benign 0.36
R3086:Olfr1280 UTSW 2 111316116 missense probably benign 0.36
R3148:Olfr1280 UTSW 2 111316288 missense possibly damaging 0.93
R4229:Olfr1280 UTSW 2 111316336 missense probably damaging 1.00
R4258:Olfr1280 UTSW 2 111315638 missense probably benign
R4908:Olfr1280 UTSW 2 111316229 missense probably benign 0.09
R4972:Olfr1280 UTSW 2 111315818 missense probably damaging 1.00
R5051:Olfr1280 UTSW 2 111316254 nonsense probably null
R5551:Olfr1280 UTSW 2 111315571 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GAAGTGCATCTGGCTCGTTGTGATA -3'
(R):5'- TCAGGAGAGGTGTGATGACTGTGTAAAA -3'

Sequencing Primer
(F):5'- CATGCCATGAGTCAACTGATACTG -3'
(R):5'- TGTAAAACACAGCTAGAAACTTGTCC -3'
Posted On2013-04-11