Incidental Mutation 'R1794:Ros1'
ID202060
Institutional Source Beutler Lab
Gene Symbol Ros1
Ensembl Gene ENSMUSG00000019893
Gene NameRos1 proto-oncogene
SynonymsRos-1, c-ros
MMRRC Submission 039824-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R1794 (G1)
Quality Score151
Status Not validated
Chromosome10
Chromosomal Location52045721-52195244 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 52124103 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1109 (K1109*)
Ref Sequence ENSEMBL: ENSMUSP00000151615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]
Predicted Effect probably null
Transcript: ENSMUST00000020045
AA Change: K1130*
SMART Domains Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: K1130*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 568 654 2.24e-4 SMART
LY 734 776 2.28e1 SMART
LY 777 815 4.61e0 SMART
FN3 944 1023 5.53e-4 SMART
FN3 1037 1133 1.07e1 SMART
FN3 1440 1532 1.19e1 SMART
FN3 1551 1637 2.11e0 SMART
FN3 1649 1731 6.8e-4 SMART
FN3 1746 1832 2.7e1 SMART
TyrKc 1938 2208 1.3e-145 SMART
low complexity region 2294 2307 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117992
AA Change: K1109*
SMART Domains Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: K1109*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
TyrKc 1917 2187 1.3e-145 SMART
low complexity region 2273 2286 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000177378
AA Change: K1109*
SMART Domains Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: K1109*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
Blast:LY 1190 1236 2e-18 BLAST
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
transmembrane domain 1832 1854 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177387
Predicted Effect probably null
Transcript: ENSMUST00000218452
AA Change: K1109*
Predicted Effect probably null
Transcript: ENSMUST00000219173
AA Change: K1109*
Predicted Effect probably benign
Transcript: ENSMUST00000219692
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,620 E44G probably benign Het
Anxa7 A G 14: 20,471,467 Y54H unknown Het
Arhgef3 A G 14: 27,397,605 T331A probably benign Het
Arhgef40 G T 14: 51,989,930 C477F possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a5 C A 16: 29,321,709 R343L probably damaging Het
Brdt ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC 5: 107,359,853 probably benign Het
Btbd2 G T 10: 80,643,913 D426E probably damaging Het
Cabin1 A C 10: 75,725,745 I974R possibly damaging Het
Cacna1i G A 15: 80,389,122 V1670M probably damaging Het
Cc2d2a C A 5: 43,688,252 Q288K probably damaging Het
Ccl20 T A 1: 83,117,829 I37K possibly damaging Het
Cdcp1 A G 9: 123,190,094 V40A probably benign Het
Cdcp1 T C 9: 123,215,831 T27A probably benign Het
Cdh4 C T 2: 179,886,842 T581I probably damaging Het
Cgn A G 3: 94,762,557 probably null Het
Col7a1 G A 9: 108,965,928 G1493D unknown Het
Creb3 A G 4: 43,563,302 E133G probably benign Het
Dchs1 T C 7: 105,771,720 T498A probably benign Het
Dis3l A C 9: 64,317,776 V413G possibly damaging Het
Dnah6 T C 6: 73,024,958 E3865G probably damaging Het
Fam219b A G 9: 57,539,281 Y139C probably damaging Het
Fat3 A T 9: 15,997,136 Y2523* probably null Het
Fat3 A T 9: 15,997,138 Y2523N probably benign Het
Fmnl1 T C 11: 103,197,147 S40P probably benign Het
Gm17727 T A 9: 35,777,122 I56F probably benign Het
Gm4792 T C 10: 94,298,490 D6G unknown Het
Hhat G T 1: 192,693,906 Y306* probably null Het
Hmcn1 A G 1: 150,598,285 I4802T probably benign Het
Hmcn1 G A 1: 150,627,152 T3908I probably damaging Het
Hsph1 A T 5: 149,630,773 N79K probably damaging Het
Ikbke T A 1: 131,259,218 Y579F probably damaging Het
Jak2 A G 19: 29,299,557 D838G probably benign Het
Klhdc7b T C 15: 89,387,020 S702P probably benign Het
Lingo3 C A 10: 80,835,598 R166L probably benign Het
Lins1 T C 7: 66,711,909 F436S probably damaging Het
Lman1 T C 18: 65,991,684 D328G probably benign Het
Lox A G 18: 52,528,307 C232R probably damaging Het
Lrrc59 T C 11: 94,638,595 V165A probably benign Het
Map9 A G 3: 82,380,221 D50G probably damaging Het
March1 T A 8: 66,386,942 Y126N possibly damaging Het
Mcf2l T C 8: 12,915,982 F3L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nin G A 12: 70,043,795 Q949* probably null Het
Nlgn3 A G X: 101,320,033 H636R probably benign Het
Notch2 A G 3: 98,099,547 D411G possibly damaging Het
Olfr1263 A G 2: 90,015,020 Y30C probably damaging Het
Olfr1449 G C 19: 12,934,968 A77P probably damaging Het
Plekha7 A G 7: 116,140,681 V579A probably damaging Het
Prrc2c T C 1: 162,705,959 probably benign Het
Rab7b T C 1: 131,697,068 probably null Het
Reg3b G T 6: 78,372,214 probably null Het
Rgs20 A G 1: 4,910,572 Y177H probably damaging Het
Ripk3 G T 14: 55,785,329 N379K probably benign Het
Rnf220 G T 4: 117,307,568 Q7K probably benign Het
Slc22a7 T G 17: 46,433,153 R460S probably damaging Het
Slc4a2 A G 5: 24,439,328 M975V probably damaging Het
Slc4a3 A T 1: 75,557,308 I1100F probably damaging Het
Smco1 A G 16: 32,274,132 E207G probably benign Het
Snrnp200 A G 2: 127,216,736 E369G probably benign Het
Tcf4 T A 18: 69,657,853 M178K probably benign Het
Tex2 T C 11: 106,567,902 probably benign Het
Tjp1 A T 7: 65,323,129 I521N probably damaging Het
Tmem203 A G 2: 25,255,994 T109A probably benign Het
Tmem50b T C 16: 91,578,029 I126V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,862,809 F3813L probably benign Het
Vmn1r203 C T 13: 22,524,351 R101W probably damaging Het
Vmn2r79 G A 7: 87,001,413 V136I probably benign Het
Wdr38 A G 2: 39,000,729 Y205C probably damaging Het
Zfp248 A G 6: 118,429,303 F442L probably damaging Het
Znrf4 A G 17: 56,511,599 I236T probably damaging Het
Other mutations in Ros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ros1 APN 10 52194890 missense probably benign 0.01
IGL00338:Ros1 APN 10 52125811 missense probably benign
IGL00419:Ros1 APN 10 52091054 missense probably damaging 0.97
IGL00840:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00841:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00951:Ros1 APN 10 52143252 missense probably damaging 0.99
IGL01123:Ros1 APN 10 52120809 missense probably damaging 1.00
IGL01128:Ros1 APN 10 52142328 nonsense probably null
IGL01300:Ros1 APN 10 52101713 missense probably benign 0.01
IGL01316:Ros1 APN 10 52087879 critical splice donor site probably null
IGL01349:Ros1 APN 10 52051026 missense probably damaging 0.99
IGL01363:Ros1 APN 10 52166142 missense probably damaging 1.00
IGL01457:Ros1 APN 10 52046330 splice site probably benign
IGL01532:Ros1 APN 10 52090938 splice site probably benign
IGL01585:Ros1 APN 10 52155102 missense probably damaging 1.00
IGL01650:Ros1 APN 10 52154979 missense probably damaging 0.99
IGL01672:Ros1 APN 10 52101803 missense possibly damaging 0.92
IGL01904:Ros1 APN 10 52077911 missense probably damaging 0.97
IGL02040:Ros1 APN 10 52115922 missense probably damaging 0.99
IGL02053:Ros1 APN 10 52162720 missense probably damaging 1.00
IGL02147:Ros1 APN 10 52120895 missense probably damaging 1.00
IGL02169:Ros1 APN 10 52081957 critical splice donor site probably null
IGL02247:Ros1 APN 10 52129581 missense probably damaging 0.99
IGL02262:Ros1 APN 10 52178969 missense probably damaging 0.96
IGL02307:Ros1 APN 10 52128438 missense possibly damaging 0.53
IGL02398:Ros1 APN 10 52144884 splice site probably benign
IGL02525:Ros1 APN 10 52116042 missense possibly damaging 0.66
IGL02718:Ros1 APN 10 52118232 missense probably damaging 1.00
IGL02721:Ros1 APN 10 52172831 splice site probably benign
IGL02808:Ros1 APN 10 52125889 missense probably damaging 1.00
IGL03009:Ros1 APN 10 52145907 missense probably benign 0.00
IGL03035:Ros1 APN 10 52075984 splice site probably benign
IGL03092:Ros1 APN 10 52098806 missense probably damaging 0.99
IGL03309:Ros1 APN 10 52118261 missense possibly damaging 0.83
IGL03333:Ros1 APN 10 52155171 missense probably damaging 1.00
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0125:Ros1 UTSW 10 52125789 missense probably benign 0.38
R0403:Ros1 UTSW 10 52143438 splice site probably benign
R0487:Ros1 UTSW 10 52155108 missense possibly damaging 0.69
R0502:Ros1 UTSW 10 52194823 splice site probably benign
R0557:Ros1 UTSW 10 52085263 missense possibly damaging 0.82
R0599:Ros1 UTSW 10 52123300 missense probably damaging 1.00
R0620:Ros1 UTSW 10 52118348 missense probably damaging 1.00
R0679:Ros1 UTSW 10 52066295 missense possibly damaging 0.95
R1005:Ros1 UTSW 10 52128405 splice site probably benign
R1073:Ros1 UTSW 10 52046125 missense probably damaging 1.00
R1220:Ros1 UTSW 10 52098870 missense probably damaging 0.97
R1279:Ros1 UTSW 10 52142166 missense possibly damaging 0.81
R1295:Ros1 UTSW 10 52087932 missense possibly damaging 0.92
R1336:Ros1 UTSW 10 52168662 missense probably damaging 1.00
R1371:Ros1 UTSW 10 52087945 missense probably damaging 0.98
R1447:Ros1 UTSW 10 52098858 missense possibly damaging 0.66
R1486:Ros1 UTSW 10 52172858 missense probably damaging 1.00
R1499:Ros1 UTSW 10 52098677 missense possibly damaging 0.92
R1669:Ros1 UTSW 10 52161811 missense probably damaging 1.00
R1744:Ros1 UTSW 10 52123379 missense probably damaging 0.99
R1759:Ros1 UTSW 10 52120826 missense probably damaging 1.00
R1791:Ros1 UTSW 10 52100087 missense probably benign 0.00
R2031:Ros1 UTSW 10 52067068 missense possibly damaging 0.88
R2115:Ros1 UTSW 10 52128555 missense probably benign 0.00
R2219:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R2290:Ros1 UTSW 10 52118381 missense probably damaging 0.96
R2329:Ros1 UTSW 10 52162887 missense probably damaging 1.00
R2371:Ros1 UTSW 10 52163895 missense possibly damaging 0.66
R2879:Ros1 UTSW 10 52172840 critical splice donor site probably null
R3154:Ros1 UTSW 10 52050981 missense probably benign
R3423:Ros1 UTSW 10 52128416 unclassified probably null
R3424:Ros1 UTSW 10 52128416 unclassified probably null
R3425:Ros1 UTSW 10 52128416 unclassified probably null
R3433:Ros1 UTSW 10 52091108 missense probably benign 0.45
R3522:Ros1 UTSW 10 52090995 nonsense probably null
R3686:Ros1 UTSW 10 52145816 missense probably damaging 1.00
R3710:Ros1 UTSW 10 52161895 nonsense probably null
R3771:Ros1 UTSW 10 52128991 missense probably damaging 0.97
R3808:Ros1 UTSW 10 52120848 missense probably benign 0.08
R3930:Ros1 UTSW 10 52194848 missense possibly damaging 0.92
R3950:Ros1 UTSW 10 52066388 missense probably damaging 1.00
R3981:Ros1 UTSW 10 52120878 missense possibly damaging 0.46
R4007:Ros1 UTSW 10 52118232 missense probably damaging 1.00
R4346:Ros1 UTSW 10 52168609 missense possibly damaging 0.92
R4382:Ros1 UTSW 10 52120959 missense possibly damaging 0.46
R4414:Ros1 UTSW 10 52162704 critical splice donor site probably null
R4450:Ros1 UTSW 10 52077942 missense probably damaging 0.98
R4468:Ros1 UTSW 10 52118356 missense probably damaging 1.00
R4569:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R4649:Ros1 UTSW 10 52129668 missense possibly damaging 0.66
R4684:Ros1 UTSW 10 52129096 missense probably damaging 1.00
R4706:Ros1 UTSW 10 52101894 missense possibly damaging 0.95
R4731:Ros1 UTSW 10 52142229 missense probably damaging 1.00
R4748:Ros1 UTSW 10 52115997 missense probably benign 0.00
R4806:Ros1 UTSW 10 52096175 missense probably damaging 0.96
R4865:Ros1 UTSW 10 52172870 missense probably damaging 0.99
R4973:Ros1 UTSW 10 52154991 missense probably damaging 0.98
R5022:Ros1 UTSW 10 52124075 missense possibly damaging 0.46
R5033:Ros1 UTSW 10 52128416 critical splice donor site probably null
R5082:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5083:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5130:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5269:Ros1 UTSW 10 52051008 missense probably damaging 1.00
R5399:Ros1 UTSW 10 52090944 critical splice donor site probably null
R5414:Ros1 UTSW 10 52155093 missense probably damaging 1.00
R5659:Ros1 UTSW 10 52143386 missense possibly damaging 0.92
R5742:Ros1 UTSW 10 52142138 critical splice donor site probably null
R5780:Ros1 UTSW 10 52194857 missense probably damaging 1.00
R5805:Ros1 UTSW 10 52123289 missense probably damaging 1.00
R5843:Ros1 UTSW 10 52166197 missense possibly damaging 0.92
R5881:Ros1 UTSW 10 52181798 missense probably benign 0.26
R6027:Ros1 UTSW 10 52163968 missense possibly damaging 0.82
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6052:Ros1 UTSW 10 52163903 missense probably benign 0.39
R6175:Ros1 UTSW 10 52101785 missense probably benign 0.02
R6315:Ros1 UTSW 10 52118210 missense probably benign
R6342:Ros1 UTSW 10 52155255 missense probably damaging 1.00
R6470:Ros1 UTSW 10 52166044 critical splice donor site probably null
R6527:Ros1 UTSW 10 52143377 missense possibly damaging 0.66
R6568:Ros1 UTSW 10 52162812 missense probably damaging 1.00
R6573:Ros1 UTSW 10 52155010 missense possibly damaging 0.84
R6653:Ros1 UTSW 10 52142203 missense probably damaging 1.00
R6959:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R7011:Ros1 UTSW 10 52180176 missense probably damaging 1.00
R7111:Ros1 UTSW 10 52181810 missense not run
Predicted Primers PCR Primer
(F):5'- GCTACTTCGGTGTGAGAAAACAG -3'
(R):5'- CCAGACCTTTCCCATGCAATG -3'

Sequencing Primer
(F):5'- TCGGTGTGAGAAAACAGTATTTTATC -3'
(R):5'- TGGAACTCACTTTGTAGACCAGC -3'
Posted On2014-06-23