Incidental Mutation 'R1794:Btbd2'
ID202062
Institutional Source Beutler Lab
Gene Symbol Btbd2
Ensembl Gene ENSMUSG00000003344
Gene NameBTB (POZ) domain containing 2
Synonyms
MMRRC Submission 039824-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R1794 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80642617-80657071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80643913 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 426 (D426E)
Ref Sequence ENSEMBL: ENSMUSP00000120751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003434] [ENSMUST00000079773] [ENSMUST00000085435] [ENSMUST00000126980]
Predicted Effect probably damaging
Transcript: ENSMUST00000003434
AA Change: D441E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003434
Gene: ENSMUSG00000003344
AA Change: D441E

DomainStartEndE-ValueType
low complexity region 27 68 N/A INTRINSIC
BTB 115 215 9.96e-25 SMART
BACK 220 328 6.36e-13 SMART
Pfam:PHR 373 522 7.1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079773
SMART Domains Protein: ENSMUSP00000078706
Gene: ENSMUSG00000003345

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Pkinase 126 329 2e-19 PFAM
Pfam:Pkinase_Tyr 128 329 6.2e-10 PFAM
Pfam:CK1gamma_C 382 412 4e-11 PFAM
low complexity region 425 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085435
SMART Domains Protein: ENSMUSP00000082560
Gene: ENSMUSG00000003345

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 308 1.3e-14 PFAM
Pfam:Pkinase 46 313 7.6e-35 PFAM
Pfam:CK1gamma_C 354 385 1.2e-11 PFAM
low complexity region 398 409 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126980
AA Change: D426E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120751
Gene: ENSMUSG00000003344
AA Change: D426E

DomainStartEndE-ValueType
low complexity region 12 53 N/A INTRINSIC
BTB 100 200 9.96e-25 SMART
BACK 205 313 6.36e-13 SMART
Pfam:PHR 358 508 4.3e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131876
SMART Domains Protein: ENSMUSP00000120780
Gene: ENSMUSG00000003344

DomainStartEndE-ValueType
BTB 2 85 4.38e-12 SMART
BACK 90 199 1.21e-13 SMART
PDB:3NO8|B 234 256 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220025
Predicted Effect probably benign
Transcript: ENSMUST00000220163
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220431
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The C-terminus of the protein encoded by this gene binds topoisomerase I. The N-terminus contains a proline-rich region and a BTB/POZ domain (broad-complex, Tramtrack and bric a brac/Pox virus and Zinc finger), both of which are typically involved in protein-protein interactions. Subcellularly, the protein localizes to cytoplasmic bodies. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,620 E44G probably benign Het
Anxa7 A G 14: 20,471,467 Y54H unknown Het
Arhgef3 A G 14: 27,397,605 T331A probably benign Het
Arhgef40 G T 14: 51,989,930 C477F possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a5 C A 16: 29,321,709 R343L probably damaging Het
Brdt ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC 5: 107,359,853 probably benign Het
Cabin1 A C 10: 75,725,745 I974R possibly damaging Het
Cacna1i G A 15: 80,389,122 V1670M probably damaging Het
Cc2d2a C A 5: 43,688,252 Q288K probably damaging Het
Ccl20 T A 1: 83,117,829 I37K possibly damaging Het
Cdcp1 A G 9: 123,190,094 V40A probably benign Het
Cdcp1 T C 9: 123,215,831 T27A probably benign Het
Cdh4 C T 2: 179,886,842 T581I probably damaging Het
Cgn A G 3: 94,762,557 probably null Het
Col7a1 G A 9: 108,965,928 G1493D unknown Het
Creb3 A G 4: 43,563,302 E133G probably benign Het
Dchs1 T C 7: 105,771,720 T498A probably benign Het
Dis3l A C 9: 64,317,776 V413G possibly damaging Het
Dnah6 T C 6: 73,024,958 E3865G probably damaging Het
Fam219b A G 9: 57,539,281 Y139C probably damaging Het
Fat3 A T 9: 15,997,136 Y2523* probably null Het
Fat3 A T 9: 15,997,138 Y2523N probably benign Het
Fmnl1 T C 11: 103,197,147 S40P probably benign Het
Gm17727 T A 9: 35,777,122 I56F probably benign Het
Gm4792 T C 10: 94,298,490 D6G unknown Het
Hhat G T 1: 192,693,906 Y306* probably null Het
Hmcn1 A G 1: 150,598,285 I4802T probably benign Het
Hmcn1 G A 1: 150,627,152 T3908I probably damaging Het
Hsph1 A T 5: 149,630,773 N79K probably damaging Het
Ikbke T A 1: 131,259,218 Y579F probably damaging Het
Jak2 A G 19: 29,299,557 D838G probably benign Het
Klhdc7b T C 15: 89,387,020 S702P probably benign Het
Lingo3 C A 10: 80,835,598 R166L probably benign Het
Lins1 T C 7: 66,711,909 F436S probably damaging Het
Lman1 T C 18: 65,991,684 D328G probably benign Het
Lox A G 18: 52,528,307 C232R probably damaging Het
Lrrc59 T C 11: 94,638,595 V165A probably benign Het
Map9 A G 3: 82,380,221 D50G probably damaging Het
March1 T A 8: 66,386,942 Y126N possibly damaging Het
Mcf2l T C 8: 12,915,982 F3L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nin G A 12: 70,043,795 Q949* probably null Het
Nlgn3 A G X: 101,320,033 H636R probably benign Het
Notch2 A G 3: 98,099,547 D411G possibly damaging Het
Olfr1263 A G 2: 90,015,020 Y30C probably damaging Het
Olfr1449 G C 19: 12,934,968 A77P probably damaging Het
Plekha7 A G 7: 116,140,681 V579A probably damaging Het
Prrc2c T C 1: 162,705,959 probably benign Het
Rab7b T C 1: 131,697,068 probably null Het
Reg3b G T 6: 78,372,214 probably null Het
Rgs20 A G 1: 4,910,572 Y177H probably damaging Het
Ripk3 G T 14: 55,785,329 N379K probably benign Het
Rnf220 G T 4: 117,307,568 Q7K probably benign Het
Ros1 T A 10: 52,124,103 K1109* probably null Het
Slc22a7 T G 17: 46,433,153 R460S probably damaging Het
Slc4a2 A G 5: 24,439,328 M975V probably damaging Het
Slc4a3 A T 1: 75,557,308 I1100F probably damaging Het
Smco1 A G 16: 32,274,132 E207G probably benign Het
Snrnp200 A G 2: 127,216,736 E369G probably benign Het
Tcf4 T A 18: 69,657,853 M178K probably benign Het
Tex2 T C 11: 106,567,902 probably benign Het
Tjp1 A T 7: 65,323,129 I521N probably damaging Het
Tmem203 A G 2: 25,255,994 T109A probably benign Het
Tmem50b T C 16: 91,578,029 I126V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,862,809 F3813L probably benign Het
Vmn1r203 C T 13: 22,524,351 R101W probably damaging Het
Vmn2r79 G A 7: 87,001,413 V136I probably benign Het
Wdr38 A G 2: 39,000,729 Y205C probably damaging Het
Zfp248 A G 6: 118,429,303 F442L probably damaging Het
Znrf4 A G 17: 56,511,599 I236T probably damaging Het
Other mutations in Btbd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0245:Btbd2 UTSW 10 80647806 missense probably damaging 1.00
R1960:Btbd2 UTSW 10 80644705 missense probably benign 0.06
R4827:Btbd2 UTSW 10 80646389 missense probably damaging 1.00
R5197:Btbd2 UTSW 10 80646419 missense probably damaging 0.98
R5372:Btbd2 UTSW 10 80648641 missense probably damaging 0.99
R6108:Btbd2 UTSW 10 80645531 missense probably damaging 1.00
R6316:Btbd2 UTSW 10 80644778 missense probably damaging 0.98
R6355:Btbd2 UTSW 10 80645349 missense possibly damaging 0.81
R6872:Btbd2 UTSW 10 80644332 missense probably damaging 0.99
R7016:Btbd2 UTSW 10 80648615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCATAGTGAGAGTCTGGG -3'
(R):5'- TACCCATCTTGAGAGCATGCC -3'

Sequencing Primer
(F):5'- AGGATGCCCAGGACTGTTACTAC -3'
(R):5'- TCTTGAGAGCATGCCCAAGTAC -3'
Posted On2014-06-23