Incidental Mutation 'R1794:Arhgef40'
ID202073
Institutional Source Beutler Lab
Gene Symbol Arhgef40
Ensembl Gene ENSMUSG00000004562
Gene NameRho guanine nucleotide exchange factor (GEF) 40
SynonymsE130112L23Rik
MMRRC Submission 039824-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R1794 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location51984719-52006251 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 51989930 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 477 (C477F)
Ref Sequence ENSEMBL: ENSMUSP00000138797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093813] [ENSMUST00000100639] [ENSMUST00000182061] [ENSMUST00000182193] [ENSMUST00000182338] [ENSMUST00000182649] [ENSMUST00000182760] [ENSMUST00000182905] [ENSMUST00000182909] [ENSMUST00000183208]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093813
AA Change: C477F

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091331
Gene: ENSMUSG00000004562
AA Change: C477F

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 6.1e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100639
AA Change: C477F

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098204
Gene: ENSMUSG00000004562
AA Change: C477F

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1246 5.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181008
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182019
Predicted Effect possibly damaging
Transcript: ENSMUST00000182061
AA Change: C477F

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138128
Gene: ENSMUSG00000004562
AA Change: C477F

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.7e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1430 1443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182193
Predicted Effect probably benign
Transcript: ENSMUST00000182338
SMART Domains Protein: ENSMUSP00000138482
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 72 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182609
Predicted Effect probably benign
Transcript: ENSMUST00000182649
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182740
Predicted Effect probably benign
Transcript: ENSMUST00000182760
AA Change: C477F

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138125
Gene: ENSMUSG00000004562
AA Change: C477F

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 782 801 N/A INTRINSIC
low complexity region 894 923 N/A INTRINSIC
low complexity region 967 1005 N/A INTRINSIC
Pfam:RhoGEF 1096 1256 5.9e-9 PFAM
PH 1273 1381 3.97e-8 SMART
low complexity region 1412 1433 N/A INTRINSIC
low complexity region 1487 1500 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182905
AA Change: C477F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138797
Gene: ENSMUSG00000004562
AA Change: C477F

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
SCOP:d1kz7a1 1073 1162 4e-7 SMART
Blast:RhoGEF 1087 1157 1e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000182909
AA Change: C477F

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138635
Gene: ENSMUSG00000004562
AA Change: C477F

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
low complexity region 451 472 N/A INTRINSIC
low complexity region 550 564 N/A INTRINSIC
low complexity region 581 606 N/A INTRINSIC
low complexity region 773 792 N/A INTRINSIC
low complexity region 885 914 N/A INTRINSIC
low complexity region 958 996 N/A INTRINSIC
Pfam:RhoGEF 1087 1247 3.9e-9 PFAM
PH 1264 1372 3.97e-8 SMART
low complexity region 1403 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182961
Predicted Effect probably benign
Transcript: ENSMUST00000183208
SMART Domains Protein: ENSMUSP00000138354
Gene: ENSMUSG00000004562

DomainStartEndE-ValueType
low complexity region 201 223 N/A INTRINSIC
low complexity region 306 320 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
low complexity region 351 395 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to guanosine nucleotide exchange factors for Rho GTPases. The encoded protein contains in its C-terminus a GEF domain involved in exchange activity and a pleckstrin homology domain. Alternatively spliced transcripts that encode different proteins have been described. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,620 E44G probably benign Het
Anxa7 A G 14: 20,471,467 Y54H unknown Het
Arhgef3 A G 14: 27,397,605 T331A probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a5 C A 16: 29,321,709 R343L probably damaging Het
Brdt ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC 5: 107,359,853 probably benign Het
Btbd2 G T 10: 80,643,913 D426E probably damaging Het
Cabin1 A C 10: 75,725,745 I974R possibly damaging Het
Cacna1i G A 15: 80,389,122 V1670M probably damaging Het
Cc2d2a C A 5: 43,688,252 Q288K probably damaging Het
Ccl20 T A 1: 83,117,829 I37K possibly damaging Het
Cdcp1 A G 9: 123,190,094 V40A probably benign Het
Cdcp1 T C 9: 123,215,831 T27A probably benign Het
Cdh4 C T 2: 179,886,842 T581I probably damaging Het
Cgn A G 3: 94,762,557 probably null Het
Col7a1 G A 9: 108,965,928 G1493D unknown Het
Creb3 A G 4: 43,563,302 E133G probably benign Het
Dchs1 T C 7: 105,771,720 T498A probably benign Het
Dis3l A C 9: 64,317,776 V413G possibly damaging Het
Dnah6 T C 6: 73,024,958 E3865G probably damaging Het
Fam219b A G 9: 57,539,281 Y139C probably damaging Het
Fat3 A T 9: 15,997,136 Y2523* probably null Het
Fat3 A T 9: 15,997,138 Y2523N probably benign Het
Fmnl1 T C 11: 103,197,147 S40P probably benign Het
Gm17727 T A 9: 35,777,122 I56F probably benign Het
Gm4792 T C 10: 94,298,490 D6G unknown Het
Hhat G T 1: 192,693,906 Y306* probably null Het
Hmcn1 A G 1: 150,598,285 I4802T probably benign Het
Hmcn1 G A 1: 150,627,152 T3908I probably damaging Het
Hsph1 A T 5: 149,630,773 N79K probably damaging Het
Ikbke T A 1: 131,259,218 Y579F probably damaging Het
Jak2 A G 19: 29,299,557 D838G probably benign Het
Klhdc7b T C 15: 89,387,020 S702P probably benign Het
Lingo3 C A 10: 80,835,598 R166L probably benign Het
Lins1 T C 7: 66,711,909 F436S probably damaging Het
Lman1 T C 18: 65,991,684 D328G probably benign Het
Lox A G 18: 52,528,307 C232R probably damaging Het
Lrrc59 T C 11: 94,638,595 V165A probably benign Het
Map9 A G 3: 82,380,221 D50G probably damaging Het
March1 T A 8: 66,386,942 Y126N possibly damaging Het
Mcf2l T C 8: 12,915,982 F3L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nin G A 12: 70,043,795 Q949* probably null Het
Nlgn3 A G X: 101,320,033 H636R probably benign Het
Notch2 A G 3: 98,099,547 D411G possibly damaging Het
Olfr1263 A G 2: 90,015,020 Y30C probably damaging Het
Olfr1449 G C 19: 12,934,968 A77P probably damaging Het
Plekha7 A G 7: 116,140,681 V579A probably damaging Het
Prrc2c T C 1: 162,705,959 probably benign Het
Rab7b T C 1: 131,697,068 probably null Het
Reg3b G T 6: 78,372,214 probably null Het
Rgs20 A G 1: 4,910,572 Y177H probably damaging Het
Ripk3 G T 14: 55,785,329 N379K probably benign Het
Rnf220 G T 4: 117,307,568 Q7K probably benign Het
Ros1 T A 10: 52,124,103 K1109* probably null Het
Slc22a7 T G 17: 46,433,153 R460S probably damaging Het
Slc4a2 A G 5: 24,439,328 M975V probably damaging Het
Slc4a3 A T 1: 75,557,308 I1100F probably damaging Het
Smco1 A G 16: 32,274,132 E207G probably benign Het
Snrnp200 A G 2: 127,216,736 E369G probably benign Het
Tcf4 T A 18: 69,657,853 M178K probably benign Het
Tex2 T C 11: 106,567,902 probably benign Het
Tjp1 A T 7: 65,323,129 I521N probably damaging Het
Tmem203 A G 2: 25,255,994 T109A probably benign Het
Tmem50b T C 16: 91,578,029 I126V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,862,809 F3813L probably benign Het
Vmn1r203 C T 13: 22,524,351 R101W probably damaging Het
Vmn2r79 G A 7: 87,001,413 V136I probably benign Het
Wdr38 A G 2: 39,000,729 Y205C probably damaging Het
Zfp248 A G 6: 118,429,303 F442L probably damaging Het
Znrf4 A G 17: 56,511,599 I236T probably damaging Het
Other mutations in Arhgef40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Arhgef40 APN 14 51988960 missense probably damaging 1.00
IGL00848:Arhgef40 APN 14 51987427 missense probably damaging 1.00
IGL00966:Arhgef40 APN 14 51991698 critical splice donor site probably null
IGL01123:Arhgef40 APN 14 51994346 missense probably damaging 0.99
IGL02110:Arhgef40 APN 14 51989405 missense probably damaging 1.00
IGL02490:Arhgef40 APN 14 51989195 missense probably damaging 0.99
IGL02505:Arhgef40 APN 14 52000863 missense probably damaging 1.00
IGL02636:Arhgef40 APN 14 51997408 missense probably damaging 1.00
R0200:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0496:Arhgef40 UTSW 14 52004907 unclassified probably benign
R0608:Arhgef40 UTSW 14 51996974 missense probably damaging 0.99
R0826:Arhgef40 UTSW 14 52000993 missense probably benign 0.05
R1126:Arhgef40 UTSW 14 51997126 missense probably damaging 0.96
R1330:Arhgef40 UTSW 14 51990156 missense probably benign 0.42
R1612:Arhgef40 UTSW 14 52004081 missense probably damaging 1.00
R1844:Arhgef40 UTSW 14 51997623 missense probably damaging 0.99
R2018:Arhgef40 UTSW 14 52003705 missense probably damaging 1.00
R2064:Arhgef40 UTSW 14 51996183 missense probably damaging 1.00
R2321:Arhgef40 UTSW 14 51994276 splice site probably benign
R3877:Arhgef40 UTSW 14 52002285 missense probably damaging 1.00
R4233:Arhgef40 UTSW 14 51990171 missense possibly damaging 0.50
R4596:Arhgef40 UTSW 14 51987224 critical splice donor site probably null
R4676:Arhgef40 UTSW 14 51990959 nonsense probably null
R4703:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4704:Arhgef40 UTSW 14 52002310 missense probably damaging 1.00
R4719:Arhgef40 UTSW 14 52004938 unclassified probably benign
R4915:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4917:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R4918:Arhgef40 UTSW 14 51990099 missense probably damaging 1.00
R5097:Arhgef40 UTSW 14 51989689 missense probably damaging 1.00
R5183:Arhgef40 UTSW 14 52004099 missense probably damaging 0.98
R5195:Arhgef40 UTSW 14 51989812 missense possibly damaging 0.68
R5367:Arhgef40 UTSW 14 51989699 missense probably damaging 0.99
R5381:Arhgef40 UTSW 14 51991849 missense probably damaging 0.99
R5594:Arhgef40 UTSW 14 51996157 missense probably damaging 1.00
R5632:Arhgef40 UTSW 14 51994338 missense probably damaging 1.00
R5665:Arhgef40 UTSW 14 52000900 missense possibly damaging 0.80
R5798:Arhgef40 UTSW 14 51997032 missense probably damaging 1.00
R5820:Arhgef40 UTSW 14 51987496 missense possibly damaging 0.76
R6229:Arhgef40 UTSW 14 51990090 missense probably benign 0.06
R6451:Arhgef40 UTSW 14 52000999 missense probably damaging 1.00
R6633:Arhgef40 UTSW 14 51997431 missense probably damaging 1.00
R6642:Arhgef40 UTSW 14 51990962 unclassified probably benign
R6675:Arhgef40 UTSW 14 51991641 missense probably damaging 0.99
R6781:Arhgef40 UTSW 14 51997897 intron probably benign
R6901:Arhgef40 UTSW 14 51997368 missense probably damaging 1.00
U24488:Arhgef40 UTSW 14 51998216 missense probably benign 0.07
X0023:Arhgef40 UTSW 14 52003684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCAGGAAGTCCTTGTCAG -3'
(R):5'- AACATTCTGCACAGTCTCCAGG -3'

Sequencing Primer
(F):5'- CAGGAAGTCCTTGTCAGTCTGC -3'
(R):5'- ACAGTCTCCAGGGGCTGTG -3'
Posted On2014-06-23