Incidental Mutation 'R1794:Lox'
ID202085
Institutional Source Beutler Lab
Gene Symbol Lox
Ensembl Gene ENSMUSG00000024529
Gene Namelysyl oxidase
SynonymsTSC-160, ras recision gene (rrg)
MMRRC Submission 039824-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1794 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location52516069-52529867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52528307 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 232 (C232R)
Ref Sequence ENSEMBL: ENSMUSP00000129247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025409] [ENSMUST00000171470]
Predicted Effect probably damaging
Transcript: ENSMUST00000025409
AA Change: C232R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025409
Gene: ENSMUSG00000024529
AA Change: C232R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 107 116 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
Pfam:Lysyl_oxidase 207 411 2.3e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171470
AA Change: C232R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129247
Gene: ENSMUSG00000024529
AA Change: C232R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 107 116 N/A INTRINSIC
low complexity region 126 139 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
Pfam:Lysyl_oxidase 207 408 3.7e-96 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a precursor protein that belongs to the lysyl oxidase family of proteins. The secreted proprotein is proteolytically processed to an active mature peptide and a propeptide. This propeptide is thought to function in tumor suppression by inhibiting the Ras signaling pathway. The active enzyme plays a role in cross-linking of collagen and elastin and is essential for development of cardiovascular and respiratory systems, and development of skin and connective tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to altered arterial wall structure, aortic aneurysms, cardiovascular dysfunction, diaphragmatic hernia, and perinatal death. Abnormal development of the respiratory system, and elastic and collagen fiber abnormalities in the lung and skin are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,620 E44G probably benign Het
Anxa7 A G 14: 20,471,467 Y54H unknown Het
Arhgef3 A G 14: 27,397,605 T331A probably benign Het
Arhgef40 G T 14: 51,989,930 C477F possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a5 C A 16: 29,321,709 R343L probably damaging Het
Brdt ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC 5: 107,359,853 probably benign Het
Btbd2 G T 10: 80,643,913 D426E probably damaging Het
Cabin1 A C 10: 75,725,745 I974R possibly damaging Het
Cacna1i G A 15: 80,389,122 V1670M probably damaging Het
Cc2d2a C A 5: 43,688,252 Q288K probably damaging Het
Ccl20 T A 1: 83,117,829 I37K possibly damaging Het
Cdcp1 A G 9: 123,190,094 V40A probably benign Het
Cdcp1 T C 9: 123,215,831 T27A probably benign Het
Cdh4 C T 2: 179,886,842 T581I probably damaging Het
Cgn A G 3: 94,762,557 probably null Het
Col7a1 G A 9: 108,965,928 G1493D unknown Het
Creb3 A G 4: 43,563,302 E133G probably benign Het
Dchs1 T C 7: 105,771,720 T498A probably benign Het
Dis3l A C 9: 64,317,776 V413G possibly damaging Het
Dnah6 T C 6: 73,024,958 E3865G probably damaging Het
Fam219b A G 9: 57,539,281 Y139C probably damaging Het
Fat3 A T 9: 15,997,136 Y2523* probably null Het
Fat3 A T 9: 15,997,138 Y2523N probably benign Het
Fmnl1 T C 11: 103,197,147 S40P probably benign Het
Gm17727 T A 9: 35,777,122 I56F probably benign Het
Gm4792 T C 10: 94,298,490 D6G unknown Het
Hhat G T 1: 192,693,906 Y306* probably null Het
Hmcn1 A G 1: 150,598,285 I4802T probably benign Het
Hmcn1 G A 1: 150,627,152 T3908I probably damaging Het
Hsph1 A T 5: 149,630,773 N79K probably damaging Het
Ikbke T A 1: 131,259,218 Y579F probably damaging Het
Jak2 A G 19: 29,299,557 D838G probably benign Het
Klhdc7b T C 15: 89,387,020 S702P probably benign Het
Lingo3 C A 10: 80,835,598 R166L probably benign Het
Lins1 T C 7: 66,711,909 F436S probably damaging Het
Lman1 T C 18: 65,991,684 D328G probably benign Het
Lrrc59 T C 11: 94,638,595 V165A probably benign Het
Map9 A G 3: 82,380,221 D50G probably damaging Het
March1 T A 8: 66,386,942 Y126N possibly damaging Het
Mcf2l T C 8: 12,915,982 F3L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nin G A 12: 70,043,795 Q949* probably null Het
Nlgn3 A G X: 101,320,033 H636R probably benign Het
Notch2 A G 3: 98,099,547 D411G possibly damaging Het
Olfr1263 A G 2: 90,015,020 Y30C probably damaging Het
Olfr1449 G C 19: 12,934,968 A77P probably damaging Het
Plekha7 A G 7: 116,140,681 V579A probably damaging Het
Prrc2c T C 1: 162,705,959 probably benign Het
Rab7b T C 1: 131,697,068 probably null Het
Reg3b G T 6: 78,372,214 probably null Het
Rgs20 A G 1: 4,910,572 Y177H probably damaging Het
Ripk3 G T 14: 55,785,329 N379K probably benign Het
Rnf220 G T 4: 117,307,568 Q7K probably benign Het
Ros1 T A 10: 52,124,103 K1109* probably null Het
Slc22a7 T G 17: 46,433,153 R460S probably damaging Het
Slc4a2 A G 5: 24,439,328 M975V probably damaging Het
Slc4a3 A T 1: 75,557,308 I1100F probably damaging Het
Smco1 A G 16: 32,274,132 E207G probably benign Het
Snrnp200 A G 2: 127,216,736 E369G probably benign Het
Tcf4 T A 18: 69,657,853 M178K probably benign Het
Tex2 T C 11: 106,567,902 probably benign Het
Tjp1 A T 7: 65,323,129 I521N probably damaging Het
Tmem203 A G 2: 25,255,994 T109A probably benign Het
Tmem50b T C 16: 91,578,029 I126V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,862,809 F3813L probably benign Het
Vmn1r203 C T 13: 22,524,351 R101W probably damaging Het
Vmn2r79 G A 7: 87,001,413 V136I probably benign Het
Wdr38 A G 2: 39,000,729 Y205C probably damaging Het
Zfp248 A G 6: 118,429,303 F442L probably damaging Het
Znrf4 A G 17: 56,511,599 I236T probably damaging Het
Other mutations in Lox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Lox APN 18 52520854 missense possibly damaging 0.74
IGL02457:Lox APN 18 52521316 missense probably damaging 1.00
IGL02665:Lox APN 18 52525244 splice site probably benign
R0040:Lox UTSW 18 52520826 missense possibly damaging 0.91
R0383:Lox UTSW 18 52529199 missense possibly damaging 0.50
R0658:Lox UTSW 18 52528883 missense probably benign 0.00
R1391:Lox UTSW 18 52528819 missense probably damaging 0.99
R1721:Lox UTSW 18 52520911 critical splice acceptor site probably null
R3122:Lox UTSW 18 52525105 missense probably damaging 0.97
R5436:Lox UTSW 18 52529103 missense probably benign
R5679:Lox UTSW 18 52528917 missense probably benign 0.00
R6739:Lox UTSW 18 52526959 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CTTTCACTGAAGCAGCACGC -3'
(R):5'- GGAATCTGATGGAAACCGCG -3'

Sequencing Primer
(F):5'- TGAAGCAGCACGCATAAAAACATTC -3'
(R):5'- TGGCACCAGCAGTTTCC -3'
Posted On2014-06-23