Incidental Mutation 'R1794:Tcf4'
ID202088
Institutional Source Beutler Lab
Gene Symbol Tcf4
Ensembl Gene ENSMUSG00000053477
Gene Nametranscription factor 4
SynonymsMITF-2B, ITF-2, MITF-2A, ME2, SEF2-1, 5730422P05Rik, ASP-I2, SEF-2, bHLHb19, TFE, E2.2, ITF-2b, E2-2
MMRRC Submission 039824-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1794 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location69343356-69689079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 69657853 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 178 (M178K)
Ref Sequence ENSEMBL: ENSMUSP00000144488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066717] [ENSMUST00000078486] [ENSMUST00000114977] [ENSMUST00000114978] [ENSMUST00000114980] [ENSMUST00000114982] [ENSMUST00000114985] [ENSMUST00000200703] [ENSMUST00000200862] [ENSMUST00000201037] [ENSMUST00000201091] [ENSMUST00000201094] [ENSMUST00000201205] [ENSMUST00000201410] [ENSMUST00000201631] [ENSMUST00000201781] [ENSMUST00000201964] [ENSMUST00000202057] [ENSMUST00000202116] [ENSMUST00000202354] [ENSMUST00000202435] [ENSMUST00000202458] [ENSMUST00000202474] [ENSMUST00000202477] [ENSMUST00000202610] [ENSMUST00000202674] [ENSMUST00000202751] [ENSMUST00000202772] [ENSMUST00000202937] [ENSMUST00000209116]
Predicted Effect probably benign
Transcript: ENSMUST00000066717
AA Change: M439K

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000067318
Gene: ENSMUSG00000053477
AA Change: M439K

DomainStartEndE-ValueType
low complexity region 244 252 N/A INTRINSIC
low complexity region 358 369 N/A INTRINSIC
low complexity region 452 464 N/A INTRINSIC
low complexity region 488 501 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
low complexity region 546 564 N/A INTRINSIC
HLH 595 648 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078486
AA Change: M417K

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000077577
Gene: ENSMUSG00000053477
AA Change: M417K

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
HLH 573 626 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114977
AA Change: M258K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110628
Gene: ENSMUSG00000053477
AA Change: M258K

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
low complexity region 343 361 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
HLH 410 463 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114978
AA Change: M258K

PolyPhen 2 Score 0.315 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110629
Gene: ENSMUSG00000053477
AA Change: M258K

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
low complexity region 343 361 N/A INTRINSIC
low complexity region 365 383 N/A INTRINSIC
HLH 414 467 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114980
AA Change: M417K

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110631
Gene: ENSMUSG00000053477
AA Change: M417K

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114982
AA Change: M417K

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110633
Gene: ENSMUSG00000053477
AA Change: M417K

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114985
AA Change: M417K

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000110636
Gene: ENSMUSG00000053477
AA Change: M417K

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 542 N/A INTRINSIC
HLH 573 626 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200703
SMART Domains Protein: ENSMUSP00000144583
Gene: ENSMUSG00000053477

DomainStartEndE-ValueType
low complexity region 7 15 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200862
AA Change: M288K

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144338
Gene: ENSMUSG00000053477
AA Change: M288K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201037
AA Change: M178K

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144488
Gene: ENSMUSG00000053477
AA Change: M178K

DomainStartEndE-ValueType
low complexity region 97 108 N/A INTRINSIC
low complexity region 191 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201081
Predicted Effect probably benign
Transcript: ENSMUST00000201091
AA Change: M257K

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144386
Gene: ENSMUSG00000053477
AA Change: M257K

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201094
AA Change: M288K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144169
Gene: ENSMUSG00000053477
AA Change: M288K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201157
Predicted Effect probably benign
Transcript: ENSMUST00000201205
AA Change: M288K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144273
Gene: ENSMUSG00000053477
AA Change: M288K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 413 N/A INTRINSIC
HLH 444 497 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201410
AA Change: M288K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000143950
Gene: ENSMUSG00000053477
AA Change: M288K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201631
AA Change: M393K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144285
Gene: ENSMUSG00000053477
AA Change: M393K

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 521 N/A INTRINSIC
HLH 545 598 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201781
AA Change: M393K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144209
Gene: ENSMUSG00000053477
AA Change: M393K

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
HLH 549 602 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201964
SMART Domains Protein: ENSMUSP00000144070
Gene: ENSMUSG00000053477

DomainStartEndE-ValueType
low complexity region 7 15 N/A INTRINSIC
low complexity region 121 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202057
AA Change: M288K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144647
Gene: ENSMUSG00000053477
AA Change: M288K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202116
AA Change: M417K

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000144512
Gene: ENSMUSG00000053477
AA Change: M417K

DomainStartEndE-ValueType
low complexity region 222 230 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
low complexity region 466 479 N/A INTRINSIC
low complexity region 502 520 N/A INTRINSIC
low complexity region 524 545 N/A INTRINSIC
HLH 569 622 3.57e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202354
AA Change: M392K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000144646
Gene: ENSMUSG00000053477
AA Change: M392K

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
low complexity region 477 495 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
HLH 544 597 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202435
AA Change: M393K

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144407
Gene: ENSMUSG00000053477
AA Change: M393K

DomainStartEndE-ValueType
low complexity region 198 206 N/A INTRINSIC
low complexity region 312 323 N/A INTRINSIC
low complexity region 406 418 N/A INTRINSIC
low complexity region 442 455 N/A INTRINSIC
low complexity region 478 496 N/A INTRINSIC
low complexity region 500 518 N/A INTRINSIC
HLH 549 602 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202458
AA Change: M338K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000143875
Gene: ENSMUSG00000053477
AA Change: M338K

DomainStartEndE-ValueType
low complexity region 143 151 N/A INTRINSIC
low complexity region 257 268 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
low complexity region 387 400 N/A INTRINSIC
low complexity region 423 441 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
HLH 490 543 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202474
AA Change: M258K

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143820
Gene: ENSMUSG00000053477
AA Change: M258K

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
low complexity region 271 283 N/A INTRINSIC
low complexity region 307 320 N/A INTRINSIC
low complexity region 343 361 N/A INTRINSIC
low complexity region 365 386 N/A INTRINSIC
HLH 410 463 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202477
AA Change: M288K

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000144219
Gene: ENSMUSG00000053477
AA Change: M288K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 416 N/A INTRINSIC
HLH 440 493 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202610
AA Change: M357K

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000144670
Gene: ENSMUSG00000053477
AA Change: M357K

DomainStartEndE-ValueType
low complexity region 162 170 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
low complexity region 442 460 N/A INTRINSIC
low complexity region 464 482 N/A INTRINSIC
HLH 513 566 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202674
AA Change: M392K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000144221
Gene: ENSMUSG00000053477
AA Change: M392K

DomainStartEndE-ValueType
low complexity region 197 205 N/A INTRINSIC
low complexity region 311 322 N/A INTRINSIC
low complexity region 405 417 N/A INTRINSIC
low complexity region 441 454 N/A INTRINSIC
low complexity region 477 495 N/A INTRINSIC
low complexity region 499 520 N/A INTRINSIC
HLH 544 597 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202751
SMART Domains Protein: ENSMUSP00000144064
Gene: ENSMUSG00000053477

DomainStartEndE-ValueType
low complexity region 63 71 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202772
AA Change: M357K

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000143987
Gene: ENSMUSG00000053477
AA Change: M357K

DomainStartEndE-ValueType
low complexity region 162 170 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 370 382 N/A INTRINSIC
low complexity region 406 419 N/A INTRINSIC
low complexity region 442 460 N/A INTRINSIC
low complexity region 464 485 N/A INTRINSIC
HLH 509 562 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202937
AA Change: M288K

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143857
Gene: ENSMUSG00000053477
AA Change: M288K

DomainStartEndE-ValueType
low complexity region 93 101 N/A INTRINSIC
low complexity region 207 218 N/A INTRINSIC
low complexity region 301 313 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
low complexity region 373 391 N/A INTRINSIC
low complexity region 395 413 N/A INTRINSIC
HLH 444 497 1.6e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209116
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes transcription factor 4, a basic helix-loop-helix transcription factor. The encoded protein recognizes an Ephrussi-box ('E-box') binding site ('CANNTG') - a motif first identified in immunoglobulin enhancers. This gene is broadly expressed, and may play an important role in nervous system development. Defects in this gene are a cause of Pitt-Hopkins syndrome. In addition, an intronic CTG repeat normally numbering 10-37 repeat units can expand to >50 repeat units and cause Fuchs endothelial corneal dystrophy. Multiple alternatively spliced transcript variants that encode different proteins have been described. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show a partial block in early thymopoiesis, increased double-negative T cell count, and increased sensitivity to anti-CD3 induced apoptosis. Homozygotes for another null allele show neonatal or postnatal lethality, reduced pro-B cell number, and abnormal pontine nuclei. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,620 E44G probably benign Het
Anxa7 A G 14: 20,471,467 Y54H unknown Het
Arhgef3 A G 14: 27,397,605 T331A probably benign Het
Arhgef40 G T 14: 51,989,930 C477F possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a5 C A 16: 29,321,709 R343L probably damaging Het
Brdt ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC 5: 107,359,853 probably benign Het
Btbd2 G T 10: 80,643,913 D426E probably damaging Het
Cabin1 A C 10: 75,725,745 I974R possibly damaging Het
Cacna1i G A 15: 80,389,122 V1670M probably damaging Het
Cc2d2a C A 5: 43,688,252 Q288K probably damaging Het
Ccl20 T A 1: 83,117,829 I37K possibly damaging Het
Cdcp1 A G 9: 123,190,094 V40A probably benign Het
Cdcp1 T C 9: 123,215,831 T27A probably benign Het
Cdh4 C T 2: 179,886,842 T581I probably damaging Het
Cgn A G 3: 94,762,557 probably null Het
Col7a1 G A 9: 108,965,928 G1493D unknown Het
Creb3 A G 4: 43,563,302 E133G probably benign Het
Dchs1 T C 7: 105,771,720 T498A probably benign Het
Dis3l A C 9: 64,317,776 V413G possibly damaging Het
Dnah6 T C 6: 73,024,958 E3865G probably damaging Het
Fam219b A G 9: 57,539,281 Y139C probably damaging Het
Fat3 A T 9: 15,997,136 Y2523* probably null Het
Fat3 A T 9: 15,997,138 Y2523N probably benign Het
Fmnl1 T C 11: 103,197,147 S40P probably benign Het
Gm17727 T A 9: 35,777,122 I56F probably benign Het
Gm4792 T C 10: 94,298,490 D6G unknown Het
Hhat G T 1: 192,693,906 Y306* probably null Het
Hmcn1 A G 1: 150,598,285 I4802T probably benign Het
Hmcn1 G A 1: 150,627,152 T3908I probably damaging Het
Hsph1 A T 5: 149,630,773 N79K probably damaging Het
Ikbke T A 1: 131,259,218 Y579F probably damaging Het
Jak2 A G 19: 29,299,557 D838G probably benign Het
Klhdc7b T C 15: 89,387,020 S702P probably benign Het
Lingo3 C A 10: 80,835,598 R166L probably benign Het
Lins1 T C 7: 66,711,909 F436S probably damaging Het
Lman1 T C 18: 65,991,684 D328G probably benign Het
Lox A G 18: 52,528,307 C232R probably damaging Het
Lrrc59 T C 11: 94,638,595 V165A probably benign Het
Map9 A G 3: 82,380,221 D50G probably damaging Het
March1 T A 8: 66,386,942 Y126N possibly damaging Het
Mcf2l T C 8: 12,915,982 F3L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nin G A 12: 70,043,795 Q949* probably null Het
Nlgn3 A G X: 101,320,033 H636R probably benign Het
Notch2 A G 3: 98,099,547 D411G possibly damaging Het
Olfr1263 A G 2: 90,015,020 Y30C probably damaging Het
Olfr1449 G C 19: 12,934,968 A77P probably damaging Het
Plekha7 A G 7: 116,140,681 V579A probably damaging Het
Prrc2c T C 1: 162,705,959 probably benign Het
Rab7b T C 1: 131,697,068 probably null Het
Reg3b G T 6: 78,372,214 probably null Het
Rgs20 A G 1: 4,910,572 Y177H probably damaging Het
Ripk3 G T 14: 55,785,329 N379K probably benign Het
Rnf220 G T 4: 117,307,568 Q7K probably benign Het
Ros1 T A 10: 52,124,103 K1109* probably null Het
Slc22a7 T G 17: 46,433,153 R460S probably damaging Het
Slc4a2 A G 5: 24,439,328 M975V probably damaging Het
Slc4a3 A T 1: 75,557,308 I1100F probably damaging Het
Smco1 A G 16: 32,274,132 E207G probably benign Het
Snrnp200 A G 2: 127,216,736 E369G probably benign Het
Tex2 T C 11: 106,567,902 probably benign Het
Tjp1 A T 7: 65,323,129 I521N probably damaging Het
Tmem203 A G 2: 25,255,994 T109A probably benign Het
Tmem50b T C 16: 91,578,029 I126V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,862,809 F3813L probably benign Het
Vmn1r203 C T 13: 22,524,351 R101W probably damaging Het
Vmn2r79 G A 7: 87,001,413 V136I probably benign Het
Wdr38 A G 2: 39,000,729 Y205C probably damaging Het
Zfp248 A G 6: 118,429,303 F442L probably damaging Het
Znrf4 A G 17: 56,511,599 I236T probably damaging Het
Other mutations in Tcf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Tcf4 APN 18 69655019 missense probably damaging 1.00
IGL02131:Tcf4 APN 18 69564626 splice site probably benign
IGL02221:Tcf4 APN 18 69347367 missense probably damaging 1.00
IGL02420:Tcf4 APN 18 69564139 missense probably damaging 1.00
IGL02560:Tcf4 APN 18 69643022 unclassified probably benign
IGL02637:Tcf4 APN 18 69347350 missense probably damaging 1.00
IGL03056:Tcf4 APN 18 69651212 splice site probably benign
R0374:Tcf4 UTSW 18 69681812 splice site probably benign
R1265:Tcf4 UTSW 18 69642932 missense possibly damaging 0.93
R1739:Tcf4 UTSW 18 69642970 missense probably damaging 1.00
R4703:Tcf4 UTSW 18 69657910 missense probably damaging 1.00
R4735:Tcf4 UTSW 18 69564155 missense possibly damaging 0.59
R4993:Tcf4 UTSW 18 69681769 missense probably damaging 1.00
R5191:Tcf4 UTSW 18 69642883 missense probably damaging 1.00
R5318:Tcf4 UTSW 18 69465430 missense possibly damaging 0.90
R5634:Tcf4 UTSW 18 69636847 missense possibly damaging 0.88
R6337:Tcf4 UTSW 18 69633580 missense probably damaging 1.00
R6658:Tcf4 UTSW 18 69657802 missense probably null 1.00
R6868:Tcf4 UTSW 18 69657650 intron probably null
R6907:Tcf4 UTSW 18 69652413 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGGATTCTGCTTTGTGC -3'
(R):5'- ACTCAACCAACTGTGTGATGG -3'

Sequencing Primer
(F):5'- ACCGTTTGGAAAGACTGG -3'
(R):5'- GATGGTCACGCAATCCTGTGAAC -3'
Posted On2014-06-23