Incidental Mutation 'R1794:Nlgn3'
ID202091
Institutional Source Beutler Lab
Gene Symbol Nlgn3
Ensembl Gene ENSMUSG00000031302
Gene Nameneuroligin 3
SynonymsNL3, A230085M13Rik, HNL3
MMRRC Submission 039824-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R1794 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location101299168-101325963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101320033 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 636 (H636R)
Ref Sequence ENSEMBL: ENSMUSP00000113863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065858] [ENSMUST00000118111] [ENSMUST00000130555] [ENSMUST00000151528]
Predicted Effect probably benign
Transcript: ENSMUST00000065858
AA Change: H750R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000066304
Gene: ENSMUSG00000031302
AA Change: H750R

DomainStartEndE-ValueType
Pfam:COesterase 16 601 2.3e-194 PFAM
Pfam:Abhydrolase_3 180 342 1.7e-7 PFAM
transmembrane domain 685 707 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113671
Predicted Effect probably benign
Transcript: ENSMUST00000118111
AA Change: H636R

PolyPhen 2 Score 0.298 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113863
Gene: ENSMUSG00000031302
AA Change: H636R

DomainStartEndE-ValueType
Pfam:COesterase 3 487 3.6e-161 PFAM
Pfam:Abhydrolase_3 66 232 2.4e-7 PFAM
transmembrane domain 571 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130555
SMART Domains Protein: ENSMUSP00000122213
Gene: ENSMUSG00000031302

DomainStartEndE-ValueType
Pfam:COesterase 16 510 4.6e-179 PFAM
Pfam:Abhydrolase_3 160 323 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144860
Predicted Effect probably benign
Transcript: ENSMUST00000151528
AA Change: H770R

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123283
Gene: ENSMUSG00000031302
AA Change: H770R

DomainStartEndE-ValueType
Pfam:COesterase 16 621 3.4e-207 PFAM
Pfam:Abhydrolase_3 200 363 1.2e-6 PFAM
transmembrane domain 705 727 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of neuronal cell surface proteins. Members of this family may act as splice site-specific ligands for beta-neurexins and may be involved in the formation and remodeling of central nervous system synapses. Mutations in this gene may be associated with autism and Asperger syndrome. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice show impaired context and cued conditioning, hyperactivity, altered social behavior, less vocalization, smaller brains, and impaired olfaction. Males carrying a knock-in allele show impaired social interaction, and enhanced spatial learning and inhibitory synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,620 E44G probably benign Het
Anxa7 A G 14: 20,471,467 Y54H unknown Het
Arhgef3 A G 14: 27,397,605 T331A probably benign Het
Arhgef40 G T 14: 51,989,930 C477F possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp13a5 C A 16: 29,321,709 R343L probably damaging Het
Brdt ACAGCAGCAGCAGCAGC ACAGCAGCAGCAGC 5: 107,359,853 probably benign Het
Btbd2 G T 10: 80,643,913 D426E probably damaging Het
Cabin1 A C 10: 75,725,745 I974R possibly damaging Het
Cacna1i G A 15: 80,389,122 V1670M probably damaging Het
Cc2d2a C A 5: 43,688,252 Q288K probably damaging Het
Ccl20 T A 1: 83,117,829 I37K possibly damaging Het
Cdcp1 A G 9: 123,190,094 V40A probably benign Het
Cdcp1 T C 9: 123,215,831 T27A probably benign Het
Cdh4 C T 2: 179,886,842 T581I probably damaging Het
Cgn A G 3: 94,762,557 probably null Het
Col7a1 G A 9: 108,965,928 G1493D unknown Het
Creb3 A G 4: 43,563,302 E133G probably benign Het
Dchs1 T C 7: 105,771,720 T498A probably benign Het
Dis3l A C 9: 64,317,776 V413G possibly damaging Het
Dnah6 T C 6: 73,024,958 E3865G probably damaging Het
Fam219b A G 9: 57,539,281 Y139C probably damaging Het
Fat3 A T 9: 15,997,136 Y2523* probably null Het
Fat3 A T 9: 15,997,138 Y2523N probably benign Het
Fmnl1 T C 11: 103,197,147 S40P probably benign Het
Gm17727 T A 9: 35,777,122 I56F probably benign Het
Gm4792 T C 10: 94,298,490 D6G unknown Het
Hhat G T 1: 192,693,906 Y306* probably null Het
Hmcn1 A G 1: 150,598,285 I4802T probably benign Het
Hmcn1 G A 1: 150,627,152 T3908I probably damaging Het
Hsph1 A T 5: 149,630,773 N79K probably damaging Het
Ikbke T A 1: 131,259,218 Y579F probably damaging Het
Jak2 A G 19: 29,299,557 D838G probably benign Het
Klhdc7b T C 15: 89,387,020 S702P probably benign Het
Lingo3 C A 10: 80,835,598 R166L probably benign Het
Lins1 T C 7: 66,711,909 F436S probably damaging Het
Lman1 T C 18: 65,991,684 D328G probably benign Het
Lox A G 18: 52,528,307 C232R probably damaging Het
Lrrc59 T C 11: 94,638,595 V165A probably benign Het
Map9 A G 3: 82,380,221 D50G probably damaging Het
March1 T A 8: 66,386,942 Y126N possibly damaging Het
Mcf2l T C 8: 12,915,982 F3L probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Nin G A 12: 70,043,795 Q949* probably null Het
Notch2 A G 3: 98,099,547 D411G possibly damaging Het
Olfr1263 A G 2: 90,015,020 Y30C probably damaging Het
Olfr1449 G C 19: 12,934,968 A77P probably damaging Het
Plekha7 A G 7: 116,140,681 V579A probably damaging Het
Prrc2c T C 1: 162,705,959 probably benign Het
Rab7b T C 1: 131,697,068 probably null Het
Reg3b G T 6: 78,372,214 probably null Het
Rgs20 A G 1: 4,910,572 Y177H probably damaging Het
Ripk3 G T 14: 55,785,329 N379K probably benign Het
Rnf220 G T 4: 117,307,568 Q7K probably benign Het
Ros1 T A 10: 52,124,103 K1109* probably null Het
Slc22a7 T G 17: 46,433,153 R460S probably damaging Het
Slc4a2 A G 5: 24,439,328 M975V probably damaging Het
Slc4a3 A T 1: 75,557,308 I1100F probably damaging Het
Smco1 A G 16: 32,274,132 E207G probably benign Het
Snrnp200 A G 2: 127,216,736 E369G probably benign Het
Tcf4 T A 18: 69,657,853 M178K probably benign Het
Tex2 T C 11: 106,567,902 probably benign Het
Tjp1 A T 7: 65,323,129 I521N probably damaging Het
Tmem203 A G 2: 25,255,994 T109A probably benign Het
Tmem50b T C 16: 91,578,029 I126V probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ush2a T C 1: 188,862,809 F3813L probably benign Het
Vmn1r203 C T 13: 22,524,351 R101W probably damaging Het
Vmn2r79 G A 7: 87,001,413 V136I probably benign Het
Wdr38 A G 2: 39,000,729 Y205C probably damaging Het
Zfp248 A G 6: 118,429,303 F442L probably damaging Het
Znrf4 A G 17: 56,511,599 I236T probably damaging Het
Other mutations in Nlgn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Nlgn3 APN X 101320092 missense probably benign 0.28
IGL01327:Nlgn3 APN X 101318622 missense probably benign 0.08
IGL01414:Nlgn3 APN X 101302260 missense probably benign 0.00
R1296:Nlgn3 UTSW X 101308916 splice site probably benign
R5144:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R5145:Nlgn3 UTSW X 101318285 missense probably benign 0.21
R5146:Nlgn3 UTSW X 101318285 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- CTGAATTAAGTGTCACTATCGCTG -3'
(R):5'- AGCCCAGTACTGTTGAACCC -3'

Sequencing Primer
(F):5'- TCACTATCGCTGTGGGGGC -3'
(R):5'- CCCTGCGGCAAAGGTGTTATAG -3'
Posted On2014-06-23