Incidental Mutation 'R1796:Gpsm2'
ID202231
Institutional Source Beutler Lab
Gene Symbol Gpsm2
Ensembl Gene ENSMUSG00000027883
Gene NameG-protein signalling modulator 2 (AGS3-like, C. elegans)
SynonymsLGN, 6230410J09Rik, Pins
MMRRC Submission 039826-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R1796 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location108678638-108722309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108701850 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 151 (V151A)
Ref Sequence ENSEMBL: ENSMUSP00000029482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029482] [ENSMUST00000145558]
PDB Structure
Structures of the LGN/NuMA complex [X-RAY DIFFRACTION]
crystal structure of LGN/mInscuteable complex [X-RAY DIFFRACTION]
Structure complex of LGN binding with FRMPD1 [X-RAY DIFFRACTION]
Structure of LGN GL4/Galphai3(Q147L) complex [X-RAY DIFFRACTION]
Structure of LGN GL4/Galphai1 complex [X-RAY DIFFRACTION]
Structure of LGN GL4/Galphai3 complex [X-RAY DIFFRACTION]
Structure of LGN GL3/Galphai3 complex [X-RAY DIFFRACTION]
An auto-inhibited conformation of LGN reveals a distinct interaction mode between GoLoco motifs and TPR motifs [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000029482
AA Change: V151A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029482
Gene: ENSMUSG00000027883
AA Change: V151A

DomainStartEndE-ValueType
TPR 62 95 7.86e-3 SMART
TPR 102 135 4.34e-5 SMART
Blast:TPR 142 188 9e-22 BLAST
TPR 202 235 1.69e-2 SMART
TPR 242 275 3.99e-4 SMART
TPR 282 315 1.51e-4 SMART
TPR 322 355 1.04e-2 SMART
GoLoco 490 512 3.69e-9 SMART
low complexity region 518 527 N/A INTRINSIC
GoLoco 543 565 7.27e-8 SMART
GoLoco 594 616 2.31e-10 SMART
GoLoco 628 650 2.75e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124043
Predicted Effect probably damaging
Transcript: ENSMUST00000145558
AA Change: V151A

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115759
Gene: ENSMUSG00000027883
AA Change: V151A

DomainStartEndE-ValueType
Blast:TPR 24 57 1e-10 BLAST
Pfam:TPR_8 61 84 1.5e-2 PFAM
Pfam:TPR_10 61 101 3.6e-5 PFAM
Pfam:TPR_1 62 86 7.6e-6 PFAM
Pfam:TPR_2 62 94 2e-5 PFAM
Pfam:TPR_7 64 99 1e-4 PFAM
Pfam:TPR_12 101 154 4.6e-10 PFAM
Pfam:TPR_2 102 134 7e-4 PFAM
Pfam:TPR_1 102 135 2.2e-8 PFAM
Pfam:TPR_8 102 136 5.8e-3 PFAM
Pfam:TPR_7 104 139 4.3e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154263
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of proteins that modulate activation of G proteins, which transduce extracellular signals received by cell surface receptors into integrated cellular responses. The N-terminal half of this protein contains 10 copies of leu-gly-asn (LGN) repeat, and the C-terminal half contains 4 GoLoco motifs, which are involved in guanine nucleotide exchange. This protein may play a role in neuroblast division and in the development of normal hearing. Mutations in this gene are associated with autosomal recessive nonsyndromic deafness (DFNB82). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Targeted disruption of this gene randomizes the spindle orientation of normally planar neuroepithelial divisions. The ensuing loss of the apical membrane from daughter cells frequently converts them into abnormally localized progenitors with no apparent effect on neuronal production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,155,372 P1808S probably damaging Het
Abcd4 G A 12: 84,615,382 S30F probably benign Het
Abtb1 T C 6: 88,836,619 D379G possibly damaging Het
Adgre1 A G 17: 57,441,350 I517V probably benign Het
AF366264 A T 8: 13,836,816 L425* probably null Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Angpt4 G A 2: 151,938,989 V386M probably damaging Het
Asic1 A G 15: 99,696,654 H360R probably null Het
Asxl1 G A 2: 153,401,606 A1359T probably benign Het
Atp8a2 C T 14: 60,020,758 probably null Het
BC003331 T C 1: 150,375,554 N283S probably benign Het
C1qtnf2 T A 11: 43,491,287 F279I probably damaging Het
Car8 A T 4: 8,221,671 L100* probably null Het
Cd52 T C 4: 134,094,984 M1V probably null Het
Celf5 T C 10: 81,467,219 I163V possibly damaging Het
Cep250 A T 2: 155,992,187 T2010S possibly damaging Het
Cfap65 C T 1: 74,918,948 V934M probably damaging Het
Colec11 A T 12: 28,594,859 I212N probably damaging Het
Cpa3 C T 3: 20,223,227 probably null Het
Ctnnd1 G T 2: 84,615,209 H495N probably damaging Het
Cyb5a T C 18: 84,851,561 V28A probably benign Het
Ddo A T 10: 40,647,629 Q205L probably benign Het
Dnah1 T A 14: 31,261,093 N4195I probably benign Het
E2f1 A T 2: 154,560,929 V306E probably benign Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Eef1d A C 15: 75,901,175 F25C probably damaging Het
Ehd3 A T 17: 73,830,359 I508F probably damaging Het
Eml6 T A 11: 29,881,975 I232F probably benign Het
Enc1 T A 13: 97,246,483 D500E probably benign Het
Enc1 C A 13: 97,246,485 T501K possibly damaging Het
Fam126a T G 5: 23,986,151 T173P probably damaging Het
Fam83f C T 15: 80,690,082 R213W possibly damaging Het
Fbxo31 A T 8: 121,560,438 L158* probably null Het
Foxi3 C A 6: 70,960,810 T342N possibly damaging Het
Gm996 C T 2: 25,577,988 G637D probably damaging Het
Gpr179 T A 11: 97,336,556 D1591V possibly damaging Het
Grk2 T G 19: 4,287,940 I513L probably benign Het
H2-Ab1 A G 17: 34,267,372 E135G probably damaging Het
Herc1 A T 9: 66,388,856 K578* probably null Het
Itpr2 T C 6: 146,296,673 N1533S probably benign Het
Kif3c A G 12: 3,367,299 N440S probably benign Het
Klhdc2 T C 12: 69,300,297 probably null Het
Kmo G T 1: 175,637,895 V72L probably benign Het
Krt71 A G 15: 101,742,880 I56T possibly damaging Het
Krt72 T C 15: 101,781,552 probably null Het
Krt78 T A 15: 101,950,865 Q299L probably damaging Het
Loxhd1 C T 18: 77,405,907 R1521C probably damaging Het
Loxhd1 G A 18: 77,425,639 E1774K possibly damaging Het
Ly6g6f T C 17: 35,083,502 S20G probably benign Het
Mecr T A 4: 131,865,071 M282K probably damaging Het
Mfsd14a G T 3: 116,634,947 A353D probably damaging Het
Mroh9 A T 1: 163,045,710 N564K probably damaging Het
Mrs2 T A 13: 24,997,128 T237S possibly damaging Het
Mycbpap A G 11: 94,507,551 L534S probably damaging Het
Myh1 T C 11: 67,224,357 I1906T probably benign Het
Myh4 T A 11: 67,260,324 V1935D probably benign Het
Myo18a T C 11: 77,829,344 I684T possibly damaging Het
Myo7b C T 18: 31,986,675 R788H possibly damaging Het
Nbea A T 3: 55,643,708 D2678E possibly damaging Het
Ndufs3 A C 2: 90,898,706 Y145* probably null Het
Nrros A G 16: 32,143,511 F563L probably damaging Het
Ntn4 T C 10: 93,745,771 V602A probably damaging Het
Obscn C A 11: 59,029,337 R6736L possibly damaging Het
Olfr159 T A 4: 43,770,495 D172V possibly damaging Het
Olfr26 T A 9: 38,855,524 V154D probably benign Het
Olfr698 T C 7: 106,752,549 I280V probably benign Het
Olfr837 C A 9: 19,137,917 T308K probably benign Het
Olfr969 C T 9: 39,796,005 P210L possibly damaging Het
Olfr972 A G 9: 39,873,971 E232G probably benign Het
Pik3cd A G 4: 149,654,119 F751L possibly damaging Het
Plekhh2 A G 17: 84,599,133 probably null Het
Postn A G 3: 54,373,756 H434R probably damaging Het
Prss39 A G 1: 34,500,033 D118G possibly damaging Het
Ralyl G T 3: 14,143,433 G211V possibly damaging Het
Rbak T A 5: 143,173,447 E617V probably damaging Het
Rbms3 A T 9: 116,719,333 W80R probably damaging Het
Retnlg A T 16: 48,874,247 Y86F probably benign Het
Rtel1 T A 2: 181,352,103 S643T probably benign Het
Serpina11 A T 12: 103,984,695 F256I probably damaging Het
Setd2 A T 9: 110,550,345 Y1076F probably benign Het
Setd2 A T 9: 110,617,816 probably null Het
Sgsm1 T C 5: 113,273,617 T248A possibly damaging Het
Slc6a21 T C 7: 45,280,755 Y193H probably damaging Het
Slfn9 T C 11: 82,981,955 K652E probably benign Het
Stt3b A T 9: 115,248,607 Y692* probably null Het
Sval3 A G 6: 41,968,162 Q8R probably benign Het
Synm T A 7: 67,734,000 I1305F possibly damaging Het
Tdrd1 T C 19: 56,837,783 F169L probably damaging Het
Tecta T A 9: 42,384,197 D334V probably damaging Het
Tle2 G A 10: 81,589,497 probably null Het
Tmem243 A G 5: 9,116,489 I30V probably benign Het
Treml2 T C 17: 48,309,502 *330R probably null Het
Trpm6 A G 19: 18,827,567 D961G possibly damaging Het
Ubr4 T C 4: 139,428,596 V2244A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc79 G T 12: 103,142,746 V2148F probably damaging Het
Ush2a A C 1: 188,910,827 T4129P probably benign Het
Vgll2 G A 10: 52,025,228 V85I probably damaging Het
Vmn1r16 T C 6: 57,323,271 Y122C probably benign Het
Vmn1r22 A T 6: 57,900,149 I91N probably damaging Het
Vmn2r70 A T 7: 85,563,803 Y465* probably null Het
Wdr64 A T 1: 175,717,331 E110V probably damaging Het
Wfdc6a A T 2: 164,580,311 C123S probably damaging Het
Xrcc1 A G 7: 24,547,827 Y30C probably damaging Het
Zdhhc7 T C 8: 120,085,418 K155R probably benign Het
Zfp560 A G 9: 20,351,930 F50S possibly damaging Het
Zfp616 C T 11: 74,085,845 T980I probably damaging Het
Zfp808 C T 13: 62,171,856 P300S probably damaging Het
Zfp979 G A 4: 147,613,283 T323I probably damaging Het
Other mutations in Gpsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Gpsm2 APN 3 108696987 missense probably benign 0.00
IGL01754:Gpsm2 APN 3 108703045 missense probably damaging 1.00
IGL02624:Gpsm2 APN 3 108682033 missense probably benign 0.01
IGL03005:Gpsm2 APN 3 108687006 splice site probably benign
R0482:Gpsm2 UTSW 3 108702394 splice site probably benign
R1793:Gpsm2 UTSW 3 108700909 missense probably benign 0.14
R4174:Gpsm2 UTSW 3 108702509 missense probably damaging 1.00
R7048:Gpsm2 UTSW 3 108703045 missense probably damaging 1.00
Z1088:Gpsm2 UTSW 3 108700760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAAACTTGGAAATCTCCTGAG -3'
(R):5'- CGTCCTTTTCTTGATAATAGTACTGGG -3'

Sequencing Primer
(F):5'- CTTGGAAATCTCCTGAGTAAACAC -3'
(R):5'- TCACTGGGTAAGGACACTTGC -3'
Posted On2014-06-23