Incidental Mutation 'R1796:Gpr179'
ID202293
Institutional Source Beutler Lab
Gene Symbol Gpr179
Ensembl Gene ENSMUSG00000070337
Gene NameG protein-coupled receptor 179
Synonyms5330439C02Rik
MMRRC Submission 039826-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R1796 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location97332109-97352077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97336556 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1591 (D1591V)
Ref Sequence ENSEMBL: ENSMUSP00000091474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093942]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093942
AA Change: D1591V

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000091474
Gene: ENSMUSG00000070337
AA Change: D1591V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 28 41 N/A INTRINSIC
EGF 281 357 1.91e1 SMART
Pfam:7tm_3 391 633 3.2e-40 PFAM
low complexity region 735 759 N/A INTRINSIC
low complexity region 868 880 N/A INTRINSIC
low complexity region 896 916 N/A INTRINSIC
low complexity region 959 988 N/A INTRINSIC
low complexity region 1107 1125 N/A INTRINSIC
internal_repeat_2 1156 1467 1.99e-12 PROSPERO
internal_repeat_1 1235 1674 2.85e-27 PROSPERO
internal_repeat_2 1569 1879 1.99e-12 PROSPERO
internal_repeat_1 1756 2284 2.85e-27 PROSPERO
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glutamate receptor subfamily of G protein-coupled receptors. The encoded protein has an EGF-like calcium binding domain and a seven transmembrane domain in the N-terminal region of the protein. Mutations in this gene are associated with congenital stationary night blindness type 1E. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absence of b wave without retinal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,155,372 P1808S probably damaging Het
Abcd4 G A 12: 84,615,382 S30F probably benign Het
Abtb1 T C 6: 88,836,619 D379G possibly damaging Het
Adgre1 A G 17: 57,441,350 I517V probably benign Het
AF366264 A T 8: 13,836,816 L425* probably null Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Angpt4 G A 2: 151,938,989 V386M probably damaging Het
Asic1 A G 15: 99,696,654 H360R probably null Het
Asxl1 G A 2: 153,401,606 A1359T probably benign Het
Atp8a2 C T 14: 60,020,758 probably null Het
BC003331 T C 1: 150,375,554 N283S probably benign Het
C1qtnf2 T A 11: 43,491,287 F279I probably damaging Het
Car8 A T 4: 8,221,671 L100* probably null Het
Cd52 T C 4: 134,094,984 M1V probably null Het
Celf5 T C 10: 81,467,219 I163V possibly damaging Het
Cep250 A T 2: 155,992,187 T2010S possibly damaging Het
Cfap65 C T 1: 74,918,948 V934M probably damaging Het
Colec11 A T 12: 28,594,859 I212N probably damaging Het
Cpa3 C T 3: 20,223,227 probably null Het
Ctnnd1 G T 2: 84,615,209 H495N probably damaging Het
Cyb5a T C 18: 84,851,561 V28A probably benign Het
Ddo A T 10: 40,647,629 Q205L probably benign Het
Dnah1 T A 14: 31,261,093 N4195I probably benign Het
E2f1 A T 2: 154,560,929 V306E probably benign Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Eef1d A C 15: 75,901,175 F25C probably damaging Het
Ehd3 A T 17: 73,830,359 I508F probably damaging Het
Eml6 T A 11: 29,881,975 I232F probably benign Het
Enc1 T A 13: 97,246,483 D500E probably benign Het
Enc1 C A 13: 97,246,485 T501K possibly damaging Het
Fam126a T G 5: 23,986,151 T173P probably damaging Het
Fam83f C T 15: 80,690,082 R213W possibly damaging Het
Fbxo31 A T 8: 121,560,438 L158* probably null Het
Foxi3 C A 6: 70,960,810 T342N possibly damaging Het
Gm996 C T 2: 25,577,988 G637D probably damaging Het
Gpsm2 A G 3: 108,701,850 V151A probably damaging Het
Grk2 T G 19: 4,287,940 I513L probably benign Het
H2-Ab1 A G 17: 34,267,372 E135G probably damaging Het
Herc1 A T 9: 66,388,856 K578* probably null Het
Itpr2 T C 6: 146,296,673 N1533S probably benign Het
Kif3c A G 12: 3,367,299 N440S probably benign Het
Klhdc2 T C 12: 69,300,297 probably null Het
Kmo G T 1: 175,637,895 V72L probably benign Het
Krt71 A G 15: 101,742,880 I56T possibly damaging Het
Krt72 T C 15: 101,781,552 probably null Het
Krt78 T A 15: 101,950,865 Q299L probably damaging Het
Loxhd1 C T 18: 77,405,907 R1521C probably damaging Het
Loxhd1 G A 18: 77,425,639 E1774K possibly damaging Het
Ly6g6f T C 17: 35,083,502 S20G probably benign Het
Mecr T A 4: 131,865,071 M282K probably damaging Het
Mfsd14a G T 3: 116,634,947 A353D probably damaging Het
Mroh9 A T 1: 163,045,710 N564K probably damaging Het
Mrs2 T A 13: 24,997,128 T237S possibly damaging Het
Mycbpap A G 11: 94,507,551 L534S probably damaging Het
Myh1 T C 11: 67,224,357 I1906T probably benign Het
Myh4 T A 11: 67,260,324 V1935D probably benign Het
Myo18a T C 11: 77,829,344 I684T possibly damaging Het
Myo7b C T 18: 31,986,675 R788H possibly damaging Het
Nbea A T 3: 55,643,708 D2678E possibly damaging Het
Ndufs3 A C 2: 90,898,706 Y145* probably null Het
Nrros A G 16: 32,143,511 F563L probably damaging Het
Ntn4 T C 10: 93,745,771 V602A probably damaging Het
Obscn C A 11: 59,029,337 R6736L possibly damaging Het
Olfr159 T A 4: 43,770,495 D172V possibly damaging Het
Olfr26 T A 9: 38,855,524 V154D probably benign Het
Olfr698 T C 7: 106,752,549 I280V probably benign Het
Olfr837 C A 9: 19,137,917 T308K probably benign Het
Olfr969 C T 9: 39,796,005 P210L possibly damaging Het
Olfr972 A G 9: 39,873,971 E232G probably benign Het
Pik3cd A G 4: 149,654,119 F751L possibly damaging Het
Plekhh2 A G 17: 84,599,133 probably null Het
Postn A G 3: 54,373,756 H434R probably damaging Het
Prss39 A G 1: 34,500,033 D118G possibly damaging Het
Ralyl G T 3: 14,143,433 G211V possibly damaging Het
Rbak T A 5: 143,173,447 E617V probably damaging Het
Rbms3 A T 9: 116,719,333 W80R probably damaging Het
Retnlg A T 16: 48,874,247 Y86F probably benign Het
Rtel1 T A 2: 181,352,103 S643T probably benign Het
Serpina11 A T 12: 103,984,695 F256I probably damaging Het
Setd2 A T 9: 110,550,345 Y1076F probably benign Het
Setd2 A T 9: 110,617,816 probably null Het
Sgsm1 T C 5: 113,273,617 T248A possibly damaging Het
Slc6a21 T C 7: 45,280,755 Y193H probably damaging Het
Slfn9 T C 11: 82,981,955 K652E probably benign Het
Stt3b A T 9: 115,248,607 Y692* probably null Het
Sval3 A G 6: 41,968,162 Q8R probably benign Het
Synm T A 7: 67,734,000 I1305F possibly damaging Het
Tdrd1 T C 19: 56,837,783 F169L probably damaging Het
Tecta T A 9: 42,384,197 D334V probably damaging Het
Tle2 G A 10: 81,589,497 probably null Het
Tmem243 A G 5: 9,116,489 I30V probably benign Het
Treml2 T C 17: 48,309,502 *330R probably null Het
Trpm6 A G 19: 18,827,567 D961G possibly damaging Het
Ubr4 T C 4: 139,428,596 V2244A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc79 G T 12: 103,142,746 V2148F probably damaging Het
Ush2a A C 1: 188,910,827 T4129P probably benign Het
Vgll2 G A 10: 52,025,228 V85I probably damaging Het
Vmn1r16 T C 6: 57,323,271 Y122C probably benign Het
Vmn1r22 A T 6: 57,900,149 I91N probably damaging Het
Vmn2r70 A T 7: 85,563,803 Y465* probably null Het
Wdr64 A T 1: 175,717,331 E110V probably damaging Het
Wfdc6a A T 2: 164,580,311 C123S probably damaging Het
Xrcc1 A G 7: 24,547,827 Y30C probably damaging Het
Zdhhc7 T C 8: 120,085,418 K155R probably benign Het
Zfp560 A G 9: 20,351,930 F50S possibly damaging Het
Zfp616 C T 11: 74,085,845 T980I probably damaging Het
Zfp808 C T 13: 62,171,856 P300S probably damaging Het
Zfp979 G A 4: 147,613,283 T323I probably damaging Het
Other mutations in Gpr179
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01088:Gpr179 APN 11 97337801 missense probably damaging 0.99
IGL01152:Gpr179 APN 11 97337411 missense probably benign 0.08
IGL01402:Gpr179 APN 11 97338186 nonsense probably null
IGL01404:Gpr179 APN 11 97338186 nonsense probably null
IGL01773:Gpr179 APN 11 97341366 missense probably benign 0.05
IGL02682:Gpr179 APN 11 97351865 missense probably benign
IGL02728:Gpr179 APN 11 97337900 missense probably damaging 0.99
IGL03243:Gpr179 APN 11 97351475 missense probably benign 0.02
IGL03272:Gpr179 APN 11 97336593 missense possibly damaging 0.89
IGL03347:Gpr179 APN 11 97351838 missense probably damaging 1.00
IGL03355:Gpr179 APN 11 97337608 missense possibly damaging 0.57
R0042:Gpr179 UTSW 11 97334931 missense probably benign 0.04
R0042:Gpr179 UTSW 11 97334931 missense probably benign 0.04
R0080:Gpr179 UTSW 11 97351469 missense probably benign 0.08
R0255:Gpr179 UTSW 11 97336066 missense probably benign 0.24
R0412:Gpr179 UTSW 11 97338807 missense probably damaging 1.00
R0481:Gpr179 UTSW 11 97349718 missense probably damaging 1.00
R0612:Gpr179 UTSW 11 97338438 missense possibly damaging 0.86
R0786:Gpr179 UTSW 11 97343274 missense probably damaging 1.00
R1753:Gpr179 UTSW 11 97346578 missense probably damaging 1.00
R1761:Gpr179 UTSW 11 97335106 missense probably benign 0.00
R1969:Gpr179 UTSW 11 97337958 missense probably benign
R2240:Gpr179 UTSW 11 97351733 missense probably damaging 1.00
R3855:Gpr179 UTSW 11 97341434 missense probably damaging 1.00
R3913:Gpr179 UTSW 11 97334765 missense probably benign 0.01
R4484:Gpr179 UTSW 11 97335711 missense probably benign 0.28
R4806:Gpr179 UTSW 11 97349784 missense possibly damaging 0.55
R4816:Gpr179 UTSW 11 97339248 missense probably damaging 0.99
R4906:Gpr179 UTSW 11 97346661 missense possibly damaging 0.87
R4945:Gpr179 UTSW 11 97349718 missense probably damaging 1.00
R5191:Gpr179 UTSW 11 97338149 missense possibly damaging 0.76
R5273:Gpr179 UTSW 11 97347430 missense probably damaging 1.00
R5317:Gpr179 UTSW 11 97337845 missense probably damaging 1.00
R5459:Gpr179 UTSW 11 97336657 missense probably benign 0.00
R5507:Gpr179 UTSW 11 97338330 missense probably damaging 1.00
R5523:Gpr179 UTSW 11 97336782 missense probably benign 0.37
R5536:Gpr179 UTSW 11 97343815 missense probably damaging 1.00
R5591:Gpr179 UTSW 11 97345755 missense probably benign 0.17
R5679:Gpr179 UTSW 11 97336745 missense probably benign 0.20
R5738:Gpr179 UTSW 11 97351406 missense probably damaging 1.00
R5829:Gpr179 UTSW 11 97335698 missense probably benign 0.11
R5836:Gpr179 UTSW 11 97339056 missense probably benign 0.03
R6007:Gpr179 UTSW 11 97335802 nonsense probably null
R6047:Gpr179 UTSW 11 97338416 missense probably damaging 1.00
R6339:Gpr179 UTSW 11 97344176 missense probably damaging 1.00
R6383:Gpr179 UTSW 11 97337147 missense possibly damaging 0.88
R6674:Gpr179 UTSW 11 97347405 critical splice donor site probably null
R6712:Gpr179 UTSW 11 97336167 missense possibly damaging 0.94
R6835:Gpr179 UTSW 11 97347467 missense probably damaging 1.00
R6980:Gpr179 UTSW 11 97334858 missense probably benign 0.38
R7044:Gpr179 UTSW 11 97349790 missense probably benign 0.19
R7121:Gpr179 UTSW 11 97334730 missense not run
X0065:Gpr179 UTSW 11 97347438 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AGAGAGGCTTGGGCTTTCTC -3'
(R):5'- AGTCAGTATGCCCTTGGGAG -3'

Sequencing Primer
(F):5'- GTCTCTTTGTGGGGTGCTACC -3'
(R):5'- TATGCCCTTGGGAGGATGAAGC -3'
Posted On2014-06-23