Incidental Mutation 'R1796:Unc79'
ID202298
Institutional Source Beutler Lab
Gene Symbol Unc79
Ensembl Gene ENSMUSG00000021198
Gene Nameunc-79 homolog (C. elegans)
Synonyms9030205A07Rik, Mlca3
MMRRC Submission 039826-MU
Accession Numbers

Genbank: NM_001081017; MGI: 2684729; Ensembl: ENSMUST00000085079

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1796 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location102948859-103184065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 103142746 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 2148 (V2148F)
Ref Sequence ENSEMBL: ENSMUSP00000098659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085079] [ENSMUST00000101099] [ENSMUST00000178076] [ENSMUST00000178467] [ENSMUST00000179002]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085079
AA Change: V2010F

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082156
Gene: ENSMUSG00000021198
AA Change: V2010F

DomainStartEndE-ValueType
Pfam:UNC-79 1 469 3.1e-223 PFAM
low complexity region 732 737 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1428 1440 N/A INTRINSIC
low complexity region 1471 1476 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1490 1504 N/A INTRINSIC
low complexity region 1541 1556 N/A INTRINSIC
low complexity region 1861 1870 N/A INTRINSIC
low complexity region 2237 2246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101099
AA Change: V2148F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098659
Gene: ENSMUSG00000021198
AA Change: V2148F

DomainStartEndE-ValueType
Pfam:UNC-79 113 646 1.2e-226 PFAM
low complexity region 909 914 N/A INTRINSIC
low complexity region 1023 1039 N/A INTRINSIC
low complexity region 1145 1154 N/A INTRINSIC
low complexity region 1291 1302 N/A INTRINSIC
low complexity region 1490 1502 N/A INTRINSIC
low complexity region 1605 1617 N/A INTRINSIC
low complexity region 1648 1653 N/A INTRINSIC
low complexity region 1654 1666 N/A INTRINSIC
low complexity region 1667 1681 N/A INTRINSIC
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1999 2008 N/A INTRINSIC
low complexity region 2375 2384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178076
AA Change: V2013F

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000136888
Gene: ENSMUSG00000021198
AA Change: V2013F

DomainStartEndE-ValueType
Pfam:UNC-79 1 450 4.2e-213 PFAM
low complexity region 713 718 N/A INTRINSIC
low complexity region 827 843 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 1117 1128 N/A INTRINSIC
low complexity region 1316 1328 N/A INTRINSIC
low complexity region 1431 1443 N/A INTRINSIC
low complexity region 1474 1479 N/A INTRINSIC
low complexity region 1480 1492 N/A INTRINSIC
low complexity region 1493 1507 N/A INTRINSIC
low complexity region 1544 1559 N/A INTRINSIC
low complexity region 1864 1873 N/A INTRINSIC
low complexity region 2240 2249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178467
Predicted Effect probably benign
Transcript: ENSMUST00000179002
AA Change: V2206F

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000136332
Gene: ENSMUSG00000021198
AA Change: V2206F

DomainStartEndE-ValueType
Pfam:UNC-79 60 593 1.3e-226 PFAM
low complexity region 856 861 N/A INTRINSIC
low complexity region 970 986 N/A INTRINSIC
low complexity region 1092 1101 N/A INTRINSIC
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1509 1521 N/A INTRINSIC
low complexity region 1624 1636 N/A INTRINSIC
low complexity region 1667 1672 N/A INTRINSIC
low complexity region 1673 1685 N/A INTRINSIC
low complexity region 1686 1700 N/A INTRINSIC
low complexity region 1737 1752 N/A INTRINSIC
low complexity region 2057 2066 N/A INTRINSIC
low complexity region 2433 2442 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NALCN channel is responsible for Na(+) leak currents. The protein encoded by this gene, along with UNC80, is an accessory subunit of the NALCN channel that contributes to the Ca(2+) sensitivity of the channel. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation results in lethality within the first week after birth, mostly at P0 or P1. Pups fail to nurse and have no milk in stomachs resulting in weakness, inactivity and no weight gain. [provided by MGI curators]
Allele List at MGI

 All alleles(2) : Targeted, knock-out(1) Chemically induced(1)

Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,155,372 P1808S probably damaging Het
Abcd4 G A 12: 84,615,382 S30F probably benign Het
Abtb1 T C 6: 88,836,619 D379G possibly damaging Het
Adgre1 A G 17: 57,441,350 I517V probably benign Het
AF366264 A T 8: 13,836,816 L425* probably null Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Angpt4 G A 2: 151,938,989 V386M probably damaging Het
Asic1 A G 15: 99,696,654 H360R probably null Het
Asxl1 G A 2: 153,401,606 A1359T probably benign Het
Atp8a2 C T 14: 60,020,758 probably null Het
BC003331 T C 1: 150,375,554 N283S probably benign Het
C1qtnf2 T A 11: 43,491,287 F279I probably damaging Het
Car8 A T 4: 8,221,671 L100* probably null Het
Cd52 T C 4: 134,094,984 M1V probably null Het
Celf5 T C 10: 81,467,219 I163V possibly damaging Het
Cep250 A T 2: 155,992,187 T2010S possibly damaging Het
Cfap65 C T 1: 74,918,948 V934M probably damaging Het
Colec11 A T 12: 28,594,859 I212N probably damaging Het
Cpa3 C T 3: 20,223,227 probably null Het
Ctnnd1 G T 2: 84,615,209 H495N probably damaging Het
Cyb5a T C 18: 84,851,561 V28A probably benign Het
Ddo A T 10: 40,647,629 Q205L probably benign Het
Dnah1 T A 14: 31,261,093 N4195I probably benign Het
E2f1 A T 2: 154,560,929 V306E probably benign Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Eef1d A C 15: 75,901,175 F25C probably damaging Het
Ehd3 A T 17: 73,830,359 I508F probably damaging Het
Eml6 T A 11: 29,881,975 I232F probably benign Het
Enc1 T A 13: 97,246,483 D500E probably benign Het
Enc1 C A 13: 97,246,485 T501K possibly damaging Het
Fam126a T G 5: 23,986,151 T173P probably damaging Het
Fam83f C T 15: 80,690,082 R213W possibly damaging Het
Fbxo31 A T 8: 121,560,438 L158* probably null Het
Foxi3 C A 6: 70,960,810 T342N possibly damaging Het
Gm996 C T 2: 25,577,988 G637D probably damaging Het
Gpr179 T A 11: 97,336,556 D1591V possibly damaging Het
Gpsm2 A G 3: 108,701,850 V151A probably damaging Het
Grk2 T G 19: 4,287,940 I513L probably benign Het
H2-Ab1 A G 17: 34,267,372 E135G probably damaging Het
Herc1 A T 9: 66,388,856 K578* probably null Het
Itpr2 T C 6: 146,296,673 N1533S probably benign Het
Kif3c A G 12: 3,367,299 N440S probably benign Het
Klhdc2 T C 12: 69,300,297 probably null Het
Kmo G T 1: 175,637,895 V72L probably benign Het
Krt71 A G 15: 101,742,880 I56T possibly damaging Het
Krt72 T C 15: 101,781,552 probably null Het
Krt78 T A 15: 101,950,865 Q299L probably damaging Het
Loxhd1 C T 18: 77,405,907 R1521C probably damaging Het
Loxhd1 G A 18: 77,425,639 E1774K possibly damaging Het
Ly6g6f T C 17: 35,083,502 S20G probably benign Het
Mecr T A 4: 131,865,071 M282K probably damaging Het
Mfsd14a G T 3: 116,634,947 A353D probably damaging Het
Mroh9 A T 1: 163,045,710 N564K probably damaging Het
Mrs2 T A 13: 24,997,128 T237S possibly damaging Het
Mycbpap A G 11: 94,507,551 L534S probably damaging Het
Myh1 T C 11: 67,224,357 I1906T probably benign Het
Myh4 T A 11: 67,260,324 V1935D probably benign Het
Myo18a T C 11: 77,829,344 I684T possibly damaging Het
Myo7b C T 18: 31,986,675 R788H possibly damaging Het
Nbea A T 3: 55,643,708 D2678E possibly damaging Het
Ndufs3 A C 2: 90,898,706 Y145* probably null Het
Nrros A G 16: 32,143,511 F563L probably damaging Het
Ntn4 T C 10: 93,745,771 V602A probably damaging Het
Obscn C A 11: 59,029,337 R6736L possibly damaging Het
Olfr159 T A 4: 43,770,495 D172V possibly damaging Het
Olfr26 T A 9: 38,855,524 V154D probably benign Het
Olfr698 T C 7: 106,752,549 I280V probably benign Het
Olfr837 C A 9: 19,137,917 T308K probably benign Het
Olfr969 C T 9: 39,796,005 P210L possibly damaging Het
Olfr972 A G 9: 39,873,971 E232G probably benign Het
Pik3cd A G 4: 149,654,119 F751L possibly damaging Het
Plekhh2 A G 17: 84,599,133 probably null Het
Postn A G 3: 54,373,756 H434R probably damaging Het
Prss39 A G 1: 34,500,033 D118G possibly damaging Het
Ralyl G T 3: 14,143,433 G211V possibly damaging Het
Rbak T A 5: 143,173,447 E617V probably damaging Het
Rbms3 A T 9: 116,719,333 W80R probably damaging Het
Retnlg A T 16: 48,874,247 Y86F probably benign Het
Rtel1 T A 2: 181,352,103 S643T probably benign Het
Serpina11 A T 12: 103,984,695 F256I probably damaging Het
Setd2 A T 9: 110,550,345 Y1076F probably benign Het
Setd2 A T 9: 110,617,816 probably null Het
Sgsm1 T C 5: 113,273,617 T248A possibly damaging Het
Slc6a21 T C 7: 45,280,755 Y193H probably damaging Het
Slfn9 T C 11: 82,981,955 K652E probably benign Het
Stt3b A T 9: 115,248,607 Y692* probably null Het
Sval3 A G 6: 41,968,162 Q8R probably benign Het
Synm T A 7: 67,734,000 I1305F possibly damaging Het
Tdrd1 T C 19: 56,837,783 F169L probably damaging Het
Tecta T A 9: 42,384,197 D334V probably damaging Het
Tle2 G A 10: 81,589,497 probably null Het
Tmem243 A G 5: 9,116,489 I30V probably benign Het
Treml2 T C 17: 48,309,502 *330R probably null Het
Trpm6 A G 19: 18,827,567 D961G possibly damaging Het
Ubr4 T C 4: 139,428,596 V2244A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Ush2a A C 1: 188,910,827 T4129P probably benign Het
Vgll2 G A 10: 52,025,228 V85I probably damaging Het
Vmn1r16 T C 6: 57,323,271 Y122C probably benign Het
Vmn1r22 A T 6: 57,900,149 I91N probably damaging Het
Vmn2r70 A T 7: 85,563,803 Y465* probably null Het
Wdr64 A T 1: 175,717,331 E110V probably damaging Het
Wfdc6a A T 2: 164,580,311 C123S probably damaging Het
Xrcc1 A G 7: 24,547,827 Y30C probably damaging Het
Zdhhc7 T C 8: 120,085,418 K155R probably benign Het
Zfp560 A G 9: 20,351,930 F50S possibly damaging Het
Zfp616 C T 11: 74,085,845 T980I probably damaging Het
Zfp808 C T 13: 62,171,856 P300S probably damaging Het
Zfp979 G A 4: 147,613,283 T323I probably damaging Het
Other mutations in Unc79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Unc79 APN 12 103169647 missense possibly damaging 0.68
IGL00835:Unc79 APN 12 103141890 splice site probably benign
IGL00917:Unc79 APN 12 103088507 missense possibly damaging 0.53
IGL01012:Unc79 APN 12 103112455 missense probably damaging 1.00
IGL01121:Unc79 APN 12 103165631 missense probably damaging 0.99
IGL01303:Unc79 APN 12 103161867 missense possibly damaging 0.94
IGL01305:Unc79 APN 12 103001871 missense probably damaging 0.99
IGL01315:Unc79 APN 12 103088521 missense possibly damaging 0.66
IGL01388:Unc79 APN 12 103169759 splice site probably benign
IGL01415:Unc79 APN 12 103108685 missense probably damaging 1.00
IGL01447:Unc79 APN 12 103078918 missense probably damaging 1.00
IGL01655:Unc79 APN 12 103168287 missense probably benign 0.00
IGL01662:Unc79 APN 12 103149020 missense possibly damaging 0.92
IGL01728:Unc79 APN 12 103165684 missense probably damaging 0.98
IGL01767:Unc79 APN 12 103141997 missense probably damaging 1.00
IGL02080:Unc79 APN 12 103001975 missense probably damaging 1.00
IGL02115:Unc79 APN 12 102998674 missense probably damaging 1.00
IGL02176:Unc79 APN 12 102998747 splice site probably null
IGL02186:Unc79 APN 12 103011283 missense probably benign 0.04
IGL02205:Unc79 APN 12 103079001 missense probably damaging 1.00
IGL02337:Unc79 APN 12 103156446 splice site probably benign
IGL02498:Unc79 APN 12 103171578 missense probably damaging 0.99
IGL02508:Unc79 APN 12 103112276 missense probably damaging 0.97
IGL02508:Unc79 APN 12 103112018 splice site probably benign
IGL02557:Unc79 APN 12 103182159 splice site probably benign
IGL02589:Unc79 APN 12 103173496 missense probably damaging 1.00
IGL02611:Unc79 APN 12 103165708 missense probably damaging 0.97
IGL02728:Unc79 APN 12 103122429 missense possibly damaging 0.53
IGL02827:Unc79 APN 12 103074846 missense possibly damaging 0.88
IGL03028:Unc79 APN 12 103173526 missense possibly damaging 0.83
IGL03144:Unc79 APN 12 103042142 missense probably damaging 1.00
IGL03229:Unc79 APN 12 103134539 missense probably damaging 0.99
IGL03269:Unc79 APN 12 103088677 missense probably damaging 1.00
IGL03325:Unc79 APN 12 103169610 missense probably damaging 0.98
pencil-thin UTSW 12 103108781 splice site probably null
sweetpea UTSW 12 103059518 missense probably damaging 1.00
3-1:Unc79 UTSW 12 103072750 nonsense probably null
ANU22:Unc79 UTSW 12 103001871 missense probably damaging 0.99
R0046:Unc79 UTSW 12 103125681 missense probably damaging 0.99
R0046:Unc79 UTSW 12 103125681 missense probably damaging 0.99
R0067:Unc79 UTSW 12 103059518 missense probably damaging 1.00
R0067:Unc79 UTSW 12 103059518 missense probably damaging 1.00
R0107:Unc79 UTSW 12 103134525 missense possibly damaging 0.70
R0110:Unc79 UTSW 12 103079070 critical splice donor site probably null
R0128:Unc79 UTSW 12 103088434 splice site probably benign
R0166:Unc79 UTSW 12 103156553 missense probably damaging 1.00
R0208:Unc79 UTSW 12 103092027 missense probably benign 0.00
R0211:Unc79 UTSW 12 103072792 missense probably benign 0.01
R0211:Unc79 UTSW 12 103072792 missense probably benign 0.01
R0218:Unc79 UTSW 12 103108781 splice site probably null
R0244:Unc79 UTSW 12 103112891 missense probably damaging 1.00
R0305:Unc79 UTSW 12 103113200 missense probably benign 0.18
R0310:Unc79 UTSW 12 103061407 missense probably damaging 1.00
R0325:Unc79 UTSW 12 103171644 missense probably damaging 0.98
R0369:Unc79 UTSW 12 103088772 critical splice donor site probably null
R0450:Unc79 UTSW 12 103079070 critical splice donor site probably null
R0503:Unc79 UTSW 12 103078868 missense probably benign 0.01
R0542:Unc79 UTSW 12 103094178 splice site probably benign
R0845:Unc79 UTSW 12 103173444 splice site probably benign
R0893:Unc79 UTSW 12 102991428 missense probably damaging 1.00
R1078:Unc79 UTSW 12 103074853 missense probably benign 0.03
R1148:Unc79 UTSW 12 103112667 missense probably damaging 1.00
R1148:Unc79 UTSW 12 103112667 missense probably damaging 1.00
R1159:Unc79 UTSW 12 103047052 splice site probably benign
R1191:Unc79 UTSW 12 103047012 nonsense probably null
R1307:Unc79 UTSW 12 103070076 missense probably damaging 1.00
R1368:Unc79 UTSW 12 103156513 missense probably damaging 1.00
R1476:Unc79 UTSW 12 103183525 missense probably damaging 1.00
R1650:Unc79 UTSW 12 103112793 missense possibly damaging 0.85
R1777:Unc79 UTSW 12 103112455 missense probably damaging 1.00
R1824:Unc79 UTSW 12 103059320 missense probably damaging 1.00
R1830:Unc79 UTSW 12 103134478 missense probably damaging 1.00
R1927:Unc79 UTSW 12 103169692 missense probably damaging 1.00
R1958:Unc79 UTSW 12 102991362 missense probably damaging 1.00
R1958:Unc79 UTSW 12 103074919 missense probably benign 0.19
R1980:Unc79 UTSW 12 103011279 nonsense probably null
R2019:Unc79 UTSW 12 103171571 critical splice acceptor site probably null
R2290:Unc79 UTSW 12 103146366 missense probably damaging 1.00
R2939:Unc79 UTSW 12 102991425 missense probably damaging 1.00
R2962:Unc79 UTSW 12 103095119 missense possibly damaging 0.72
R3176:Unc79 UTSW 12 103113217 missense probably damaging 1.00
R3276:Unc79 UTSW 12 103113217 missense probably damaging 1.00
R3683:Unc79 UTSW 12 103074803 missense probably benign 0.00
R3684:Unc79 UTSW 12 103074803 missense probably benign 0.00
R3686:Unc79 UTSW 12 103088661 missense probably damaging 1.00
R3760:Unc79 UTSW 12 103092705 missense probably damaging 1.00
R4031:Unc79 UTSW 12 103072759 missense possibly damaging 0.46
R4039:Unc79 UTSW 12 103074949 missense possibly damaging 0.88
R4110:Unc79 UTSW 12 103059370 missense probably damaging 1.00
R4113:Unc79 UTSW 12 103059370 missense probably damaging 1.00
R4159:Unc79 UTSW 12 103070253 intron probably benign
R4273:Unc79 UTSW 12 103122353 missense probably damaging 0.99
R4292:Unc79 UTSW 12 103183444 missense probably damaging 0.99
R4334:Unc79 UTSW 12 103078974 missense probably benign
R4513:Unc79 UTSW 12 103021760 missense probably damaging 1.00
R4562:Unc79 UTSW 12 102991461 missense probably damaging 1.00
R4576:Unc79 UTSW 12 103001803 splice site probably benign
R4645:Unc79 UTSW 12 103112822 missense probably benign
R4758:Unc79 UTSW 12 103161821 nonsense probably null
R4787:Unc79 UTSW 12 103046998 missense probably damaging 1.00
R4852:Unc79 UTSW 12 103173466 missense probably damaging 0.98
R4883:Unc79 UTSW 12 103094333 missense probably damaging 0.99
R4898:Unc79 UTSW 12 103161820 missense probably damaging 0.99
R4979:Unc79 UTSW 12 103112432 missense probably benign
R5044:Unc79 UTSW 12 103112703 missense probably benign 0.32
R5053:Unc79 UTSW 12 103104748 missense probably damaging 1.00
R5061:Unc79 UTSW 12 103168441 missense possibly damaging 0.94
R5075:Unc79 UTSW 12 103074954 missense possibly damaging 0.63
R5101:Unc79 UTSW 12 103112510 missense probably damaging 1.00
R5236:Unc79 UTSW 12 103094395 critical splice donor site probably null
R5240:Unc79 UTSW 12 103070751 missense probably damaging 0.99
R5383:Unc79 UTSW 12 103104627 missense possibly damaging 0.53
R5461:Unc79 UTSW 12 103112138 missense probably damaging 1.00
R5535:Unc79 UTSW 12 103169703 missense possibly damaging 0.84
R5609:Unc79 UTSW 12 103128268 missense probably benign
R5639:Unc79 UTSW 12 103171572 missense probably damaging 1.00
R5704:Unc79 UTSW 12 103001943 missense probably damaging 1.00
R5923:Unc79 UTSW 12 103112468 missense probably damaging 1.00
R5925:Unc79 UTSW 12 103125730 splice site probably null
R5975:Unc79 UTSW 12 103125626 missense possibly damaging 0.53
R6047:Unc79 UTSW 12 103061458 missense probably damaging 1.00
R6156:Unc79 UTSW 12 103061458 missense probably damaging 1.00
R6175:Unc79 UTSW 12 103183449 missense probably damaging 0.98
R6292:Unc79 UTSW 12 103142732 missense possibly damaging 0.88
R6313:Unc79 UTSW 12 103112619 missense probably damaging 1.00
R6391:Unc79 UTSW 12 103021010 missense probably damaging 1.00
R6405:Unc79 UTSW 12 103168336 missense probably damaging 0.97
R6416:Unc79 UTSW 12 103131646 missense possibly damaging 0.86
R6467:Unc79 UTSW 12 103173512 missense probably damaging 1.00
R6573:Unc79 UTSW 12 103061388 missense probably damaging 1.00
R6614:Unc79 UTSW 12 102991430 missense probably damaging 1.00
R6654:Unc79 UTSW 12 103079048 missense probably damaging 0.99
R6654:Unc79 UTSW 12 103079049 missense probably damaging 1.00
R6700:Unc79 UTSW 12 103125703 missense possibly damaging 0.92
R6724:Unc79 UTSW 12 103104861 missense probably damaging 1.00
R6819:Unc79 UTSW 12 103142008 missense probably benign 0.12
R6869:Unc79 UTSW 12 103113072 missense probably benign 0.33
R6879:Unc79 UTSW 12 103148787 intron probably null
R6942:Unc79 UTSW 12 103122445 critical splice donor site probably null
R6961:Unc79 UTSW 12 103112915 missense probably damaging 1.00
R6973:Unc79 UTSW 12 102998440 missense possibly damaging 0.86
R6980:Unc79 UTSW 12 103059500 missense probably damaging 1.00
R7124:Unc79 UTSW 12 103061393 missense not run
R7144:Unc79 UTSW 12 103142626 missense not run
X0017:Unc79 UTSW 12 103108261 missense probably damaging 0.99
X0028:Unc79 UTSW 12 102991403 missense probably damaging 1.00
Z1088:Unc79 UTSW 12 103021012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTTCAGCAGTTGATTGCC -3'
(R):5'- AAAGTACCCACTCCATGCTG -3'

Sequencing Primer
(F):5'- CAGCAGTTGATTGCCTATGC -3'
(R):5'- CCGACAGCAGAGTGGATGACC -3'
Posted On2014-06-23