Incidental Mutation 'R1796:Loxhd1'
ID202329
Institutional Source Beutler Lab
Gene Symbol Loxhd1
Ensembl Gene ENSMUSG00000032818
Gene Namelipoxygenase homology domains 1
Synonymssba, 1700096C21Rik
MMRRC Submission 039826-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R1796 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location77281958-77442341 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77425639 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1774 (E1774K)
Ref Sequence ENSEMBL: ENSMUSP00000094294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096547] [ENSMUST00000123166] [ENSMUST00000123410]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096547
AA Change: E1774K

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: E1774K

DomainStartEndE-ValueType
LH2 43 158 5.64e-5 SMART
LH2 172 290 1.64e-9 SMART
LH2 296 409 1.1e-4 SMART
LH2 425 539 4.02e-4 SMART
LH2 553 675 3.79e-6 SMART
LH2 684 800 5.92e-6 SMART
LH2 814 936 6.91e-8 SMART
low complexity region 945 954 N/A INTRINSIC
LH2 970 1086 4.81e-7 SMART
LH2 1101 1228 5.73e-3 SMART
LH2 1255 1375 8.82e-5 SMART
Pfam:PLAT 1424 1540 5.4e-10 PFAM
LH2 1553 1666 6.41e-3 SMART
LH2 1680 1799 6.76e-6 SMART
Pfam:PLAT 1813 1929 3.8e-9 PFAM
LH2 1949 2067 7.23e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123166
AA Change: E222K

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116287
Gene: ENSMUSG00000032818
AA Change: E222K

DomainStartEndE-ValueType
LH2 1 114 6.41e-3 SMART
LH2 128 247 6.76e-6 SMART
Pfam:PLAT 261 379 1.3e-8 PFAM
LH2 397 515 7.23e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123410
AA Change: E908K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818
AA Change: E908K

DomainStartEndE-ValueType
Pfam:PLAT 1 67 4.4e-15 PFAM
low complexity region 79 88 N/A INTRINSIC
LH2 104 220 4.81e-7 SMART
LH2 235 362 5.73e-3 SMART
LH2 389 509 8.82e-5 SMART
Pfam:PLAT 558 674 9.9e-12 PFAM
LH2 687 800 6.41e-3 SMART
LH2 814 933 6.76e-6 SMART
Pfam:PLAT 947 1065 8.8e-9 PFAM
Pfam:PLAT 1085 1174 4.2e-11 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C T 7: 28,155,372 P1808S probably damaging Het
Abcd4 G A 12: 84,615,382 S30F probably benign Het
Abtb1 T C 6: 88,836,619 D379G possibly damaging Het
Adgre1 A G 17: 57,441,350 I517V probably benign Het
AF366264 A T 8: 13,836,816 L425* probably null Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Angpt4 G A 2: 151,938,989 V386M probably damaging Het
Asic1 A G 15: 99,696,654 H360R probably null Het
Asxl1 G A 2: 153,401,606 A1359T probably benign Het
Atp8a2 C T 14: 60,020,758 probably null Het
BC003331 T C 1: 150,375,554 N283S probably benign Het
C1qtnf2 T A 11: 43,491,287 F279I probably damaging Het
Car8 A T 4: 8,221,671 L100* probably null Het
Cd52 T C 4: 134,094,984 M1V probably null Het
Celf5 T C 10: 81,467,219 I163V possibly damaging Het
Cep250 A T 2: 155,992,187 T2010S possibly damaging Het
Cfap65 C T 1: 74,918,948 V934M probably damaging Het
Colec11 A T 12: 28,594,859 I212N probably damaging Het
Cpa3 C T 3: 20,223,227 probably null Het
Ctnnd1 G T 2: 84,615,209 H495N probably damaging Het
Cyb5a T C 18: 84,851,561 V28A probably benign Het
Ddo A T 10: 40,647,629 Q205L probably benign Het
Dnah1 T A 14: 31,261,093 N4195I probably benign Het
E2f1 A T 2: 154,560,929 V306E probably benign Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Eef1d A C 15: 75,901,175 F25C probably damaging Het
Ehd3 A T 17: 73,830,359 I508F probably damaging Het
Eml6 T A 11: 29,881,975 I232F probably benign Het
Enc1 T A 13: 97,246,483 D500E probably benign Het
Enc1 C A 13: 97,246,485 T501K possibly damaging Het
Fam126a T G 5: 23,986,151 T173P probably damaging Het
Fam83f C T 15: 80,690,082 R213W possibly damaging Het
Fbxo31 A T 8: 121,560,438 L158* probably null Het
Foxi3 C A 6: 70,960,810 T342N possibly damaging Het
Gm996 C T 2: 25,577,988 G637D probably damaging Het
Gpr179 T A 11: 97,336,556 D1591V possibly damaging Het
Gpsm2 A G 3: 108,701,850 V151A probably damaging Het
Grk2 T G 19: 4,287,940 I513L probably benign Het
H2-Ab1 A G 17: 34,267,372 E135G probably damaging Het
Herc1 A T 9: 66,388,856 K578* probably null Het
Itpr2 T C 6: 146,296,673 N1533S probably benign Het
Kif3c A G 12: 3,367,299 N440S probably benign Het
Klhdc2 T C 12: 69,300,297 probably null Het
Kmo G T 1: 175,637,895 V72L probably benign Het
Krt71 A G 15: 101,742,880 I56T possibly damaging Het
Krt72 T C 15: 101,781,552 probably null Het
Krt78 T A 15: 101,950,865 Q299L probably damaging Het
Ly6g6f T C 17: 35,083,502 S20G probably benign Het
Mecr T A 4: 131,865,071 M282K probably damaging Het
Mfsd14a G T 3: 116,634,947 A353D probably damaging Het
Mroh9 A T 1: 163,045,710 N564K probably damaging Het
Mrs2 T A 13: 24,997,128 T237S possibly damaging Het
Mycbpap A G 11: 94,507,551 L534S probably damaging Het
Myh1 T C 11: 67,224,357 I1906T probably benign Het
Myh4 T A 11: 67,260,324 V1935D probably benign Het
Myo18a T C 11: 77,829,344 I684T possibly damaging Het
Myo7b C T 18: 31,986,675 R788H possibly damaging Het
Nbea A T 3: 55,643,708 D2678E possibly damaging Het
Ndufs3 A C 2: 90,898,706 Y145* probably null Het
Nrros A G 16: 32,143,511 F563L probably damaging Het
Ntn4 T C 10: 93,745,771 V602A probably damaging Het
Obscn C A 11: 59,029,337 R6736L possibly damaging Het
Olfr159 T A 4: 43,770,495 D172V possibly damaging Het
Olfr26 T A 9: 38,855,524 V154D probably benign Het
Olfr698 T C 7: 106,752,549 I280V probably benign Het
Olfr837 C A 9: 19,137,917 T308K probably benign Het
Olfr969 C T 9: 39,796,005 P210L possibly damaging Het
Olfr972 A G 9: 39,873,971 E232G probably benign Het
Pik3cd A G 4: 149,654,119 F751L possibly damaging Het
Plekhh2 A G 17: 84,599,133 probably null Het
Postn A G 3: 54,373,756 H434R probably damaging Het
Prss39 A G 1: 34,500,033 D118G possibly damaging Het
Ralyl G T 3: 14,143,433 G211V possibly damaging Het
Rbak T A 5: 143,173,447 E617V probably damaging Het
Rbms3 A T 9: 116,719,333 W80R probably damaging Het
Retnlg A T 16: 48,874,247 Y86F probably benign Het
Rtel1 T A 2: 181,352,103 S643T probably benign Het
Serpina11 A T 12: 103,984,695 F256I probably damaging Het
Setd2 A T 9: 110,550,345 Y1076F probably benign Het
Setd2 A T 9: 110,617,816 probably null Het
Sgsm1 T C 5: 113,273,617 T248A possibly damaging Het
Slc6a21 T C 7: 45,280,755 Y193H probably damaging Het
Slfn9 T C 11: 82,981,955 K652E probably benign Het
Stt3b A T 9: 115,248,607 Y692* probably null Het
Sval3 A G 6: 41,968,162 Q8R probably benign Het
Synm T A 7: 67,734,000 I1305F possibly damaging Het
Tdrd1 T C 19: 56,837,783 F169L probably damaging Het
Tecta T A 9: 42,384,197 D334V probably damaging Het
Tle2 G A 10: 81,589,497 probably null Het
Tmem243 A G 5: 9,116,489 I30V probably benign Het
Treml2 T C 17: 48,309,502 *330R probably null Het
Trpm6 A G 19: 18,827,567 D961G possibly damaging Het
Ubr4 T C 4: 139,428,596 V2244A probably benign Het
Uhrf1bp1 T C 17: 27,890,071 F1088S possibly damaging Het
Unc79 G T 12: 103,142,746 V2148F probably damaging Het
Ush2a A C 1: 188,910,827 T4129P probably benign Het
Vgll2 G A 10: 52,025,228 V85I probably damaging Het
Vmn1r16 T C 6: 57,323,271 Y122C probably benign Het
Vmn1r22 A T 6: 57,900,149 I91N probably damaging Het
Vmn2r70 A T 7: 85,563,803 Y465* probably null Het
Wdr64 A T 1: 175,717,331 E110V probably damaging Het
Wfdc6a A T 2: 164,580,311 C123S probably damaging Het
Xrcc1 A G 7: 24,547,827 Y30C probably damaging Het
Zdhhc7 T C 8: 120,085,418 K155R probably benign Het
Zfp560 A G 9: 20,351,930 F50S possibly damaging Het
Zfp616 C T 11: 74,085,845 T980I probably damaging Het
Zfp808 C T 13: 62,171,856 P300S probably damaging Het
Zfp979 G A 4: 147,613,283 T323I probably damaging Het
Other mutations in Loxhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Loxhd1 APN 18 77395450 missense probably damaging 0.99
IGL00490:Loxhd1 APN 18 77431074 missense possibly damaging 0.94
IGL00507:Loxhd1 APN 18 77332567 missense probably benign 0.03
IGL00546:Loxhd1 APN 18 77405976 missense probably damaging 0.97
IGL01369:Loxhd1 APN 18 77329201 missense possibly damaging 0.85
IGL01767:Loxhd1 APN 18 77286424 missense possibly damaging 0.71
IGL02245:Loxhd1 APN 18 77340101 missense possibly damaging 0.71
IGL02388:Loxhd1 APN 18 77369137 missense probably benign 0.18
IGL02410:Loxhd1 APN 18 77402952 missense probably benign 0.02
IGL02593:Loxhd1 APN 18 77410539 missense possibly damaging 0.91
IGL02632:Loxhd1 APN 18 77405932 missense probably damaging 0.99
IGL02692:Loxhd1 APN 18 77356913 missense probably damaging 0.99
IGL02796:Loxhd1 APN 18 77369115 splice site probably benign
IGL03032:Loxhd1 APN 18 77286473 missense possibly damaging 0.93
IGL03074:Loxhd1 APN 18 77441784 missense possibly damaging 0.75
IGL03094:Loxhd1 APN 18 77431113 missense possibly damaging 0.88
IGL03118:Loxhd1 APN 18 77380464 missense probably damaging 1.00
IGL03232:Loxhd1 APN 18 77408750 missense probably damaging 1.00
IGL03377:Loxhd1 APN 18 77441673 missense possibly damaging 0.91
H8562:Loxhd1 UTSW 18 77341931 missense possibly damaging 0.93
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0048:Loxhd1 UTSW 18 77408778 missense probably damaging 0.99
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0208:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0323:Loxhd1 UTSW 18 77369137 missense probably benign 0.18
R0332:Loxhd1 UTSW 18 77383830 synonymous probably null
R0367:Loxhd1 UTSW 18 77425757 splice site probably benign
R0709:Loxhd1 UTSW 18 77404969 missense probably benign 0.23
R0783:Loxhd1 UTSW 18 77429984 missense possibly damaging 0.58
R1132:Loxhd1 UTSW 18 77429943 missense possibly damaging 0.71
R1232:Loxhd1 UTSW 18 77406003 critical splice donor site probably null
R1331:Loxhd1 UTSW 18 77402936 missense possibly damaging 0.86
R1465:Loxhd1 UTSW 18 77380573 intron probably null
R1465:Loxhd1 UTSW 18 77380573 intron probably null
R1501:Loxhd1 UTSW 18 77356832 missense probably damaging 1.00
R1640:Loxhd1 UTSW 18 77402563 missense probably damaging 1.00
R1656:Loxhd1 UTSW 18 77321668 missense possibly damaging 0.71
R1671:Loxhd1 UTSW 18 77404802 missense probably damaging 1.00
R1725:Loxhd1 UTSW 18 77293241 missense probably benign 0.32
R1735:Loxhd1 UTSW 18 77404889 missense probably damaging 0.98
R1796:Loxhd1 UTSW 18 77405907 missense probably damaging 0.96
R1800:Loxhd1 UTSW 18 77402502 missense probably damaging 1.00
R1848:Loxhd1 UTSW 18 77281971 missense possibly damaging 0.53
R1912:Loxhd1 UTSW 18 77340137 missense probably benign 0.32
R1945:Loxhd1 UTSW 18 77404808 missense probably damaging 1.00
R1978:Loxhd1 UTSW 18 77321642 missense possibly damaging 0.86
R1997:Loxhd1 UTSW 18 77295769 missense probably damaging 0.98
R2086:Loxhd1 UTSW 18 77384946 missense probably damaging 1.00
R2153:Loxhd1 UTSW 18 77356166 missense possibly damaging 0.72
R3124:Loxhd1 UTSW 18 77431078 missense probably damaging 0.97
R3896:Loxhd1 UTSW 18 77382023 missense possibly damaging 0.65
R3907:Loxhd1 UTSW 18 77408768 missense possibly damaging 0.60
R3980:Loxhd1 UTSW 18 77414159 missense probably damaging 1.00
R4165:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4166:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4176:Loxhd1 UTSW 18 77331059 missense possibly damaging 0.53
R4345:Loxhd1 UTSW 18 77399001 missense possibly damaging 0.89
R4354:Loxhd1 UTSW 18 77395427 missense probably damaging 1.00
R4385:Loxhd1 UTSW 18 77372911 missense probably damaging 0.99
R4402:Loxhd1 UTSW 18 77441760 missense possibly damaging 0.94
R4404:Loxhd1 UTSW 18 77431132 missense probably damaging 1.00
R4456:Loxhd1 UTSW 18 77399089 missense probably damaging 1.00
R4525:Loxhd1 UTSW 18 77356912 missense probably damaging 0.98
R4605:Loxhd1 UTSW 18 77405946 missense probably benign 0.00
R4661:Loxhd1 UTSW 18 77402885 missense possibly damaging 0.79
R4698:Loxhd1 UTSW 18 77372291 missense possibly damaging 0.82
R4725:Loxhd1 UTSW 18 77395457 missense probably damaging 1.00
R4820:Loxhd1 UTSW 18 77384967 missense probably damaging 1.00
R5163:Loxhd1 UTSW 18 77361736 missense possibly damaging 0.92
R5288:Loxhd1 UTSW 18 77363612 missense probably damaging 1.00
R5328:Loxhd1 UTSW 18 77410572 missense probably damaging 1.00
R5329:Loxhd1 UTSW 18 77332682 missense probably damaging 0.98
R5347:Loxhd1 UTSW 18 77366541 missense probably damaging 1.00
R5589:Loxhd1 UTSW 18 77342055 missense possibly damaging 0.86
R5616:Loxhd1 UTSW 18 77404951 missense probably damaging 1.00
R5703:Loxhd1 UTSW 18 77356877 missense probably damaging 1.00
R5837:Loxhd1 UTSW 18 77286409 missense possibly damaging 0.71
R5888:Loxhd1 UTSW 18 77402515 missense probably damaging 0.99
R6021:Loxhd1 UTSW 18 77412250 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6153:Loxhd1 UTSW 18 77295758 missense possibly damaging 0.71
R6174:Loxhd1 UTSW 18 77412178 missense probably damaging 1.00
R6265:Loxhd1 UTSW 18 77361730 missense probably damaging 0.99
R6377:Loxhd1 UTSW 18 77380432 missense probably damaging 1.00
R6530:Loxhd1 UTSW 18 77412151 missense probably benign 0.30
R6555:Loxhd1 UTSW 18 77293269 missense possibly damaging 0.51
R6782:Loxhd1 UTSW 18 77431177 missense probably damaging 0.99
R6834:Loxhd1 UTSW 18 77441526 missense probably damaging 1.00
R7000:Loxhd1 UTSW 18 77372433 critical splice donor site probably null
R7112:Loxhd1 UTSW 18 77388514 missense not run
X0020:Loxhd1 UTSW 18 77339562 nonsense probably null
X0024:Loxhd1 UTSW 18 77395403 missense probably damaging 1.00
X0062:Loxhd1 UTSW 18 77441516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAAAGACCCCTGTGTTCC -3'
(R):5'- AACTAGACGAGTCAGCCCCTTG -3'

Sequencing Primer
(F):5'- CTGGTTGCTTCATCAACAAGG -3'
(R):5'- ACGAGTCAGCCCCTTGTCATG -3'
Posted On2014-06-23