Incidental Mutation 'R0091:Syk'
ID20235
Institutional Source Beutler Lab
Gene Symbol Syk
Ensembl Gene ENSMUSG00000021457
Gene Namespleen tyrosine kinase
SynonymsSykb
MMRRC Submission 038378-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0091 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location52583173-52648792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 52640733 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 478 (Y478C)
Ref Sequence ENSEMBL: ENSMUSP00000112914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055087] [ENSMUST00000118756] [ENSMUST00000120135]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055087
AA Change: Y501C

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060828
Gene: ENSMUSG00000021457
AA Change: Y501C

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118756
AA Change: Y478C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112914
Gene: ENSMUSG00000021457
AA Change: Y478C

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 342 582 2.68e-106 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120135
AA Change: Y501C

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113852
Gene: ENSMUSG00000021457
AA Change: Y501C

DomainStartEndE-ValueType
SH2 12 97 4.51e-26 SMART
SH2 165 249 5.06e-29 SMART
TyrKc 365 620 7.61e-120 SMART
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 97.9%
  • 10x: 94.4%
  • 20x: 84.5%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of non-receptor type Tyr protein kinases. This protein is widely expressed in hematopoietic cells and is involved in coupling activated immunoreceptors to downstream signaling events that mediate diverse cellular responses, including proliferation, differentiation, and phagocytosis. It is thought to be a modulator of epithelial cell growth and a potential tumour suppressor in human breast carcinomas. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygous null mice have high rates of postnatal lethality, exhibit developmental defects of B cells, T cells and osteoclasts, and have defective dendritic cell cross-presentation of antigens from necrotic cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,138,530 S278P possibly damaging Het
Adam11 A G 11: 102,772,839 Y281C probably damaging Het
Adam6a G T 12: 113,544,229 R74L possibly damaging Het
Adcy5 T C 16: 35,270,998 probably null Het
Adrb2 A G 18: 62,179,019 L245P probably benign Het
Aebp2 T C 6: 140,644,074 probably null Het
Arhgap23 A G 11: 97,452,244 T240A probably benign Het
Atp10a T C 7: 58,774,046 probably benign Het
Atp13a4 T A 16: 29,455,395 Y416F probably damaging Het
Atp5g2 A C 15: 102,663,057 L133R probably damaging Het
Bicral A T 17: 46,825,307 Y326N probably damaging Het
Chst4 T C 8: 110,030,665 S189G probably damaging Het
Cnot1 A T 8: 95,763,144 I477N probably damaging Het
Col7a1 G T 9: 108,967,506 probably benign Het
Dchs1 A G 7: 105,766,094 probably benign Het
Dcn A G 10: 97,506,689 N169S probably benign Het
Dnajc6 T C 4: 101,616,777 probably benign Het
Egln3 A G 12: 54,181,646 F225L probably benign Het
Erap1 G A 13: 74,668,052 R100Q possibly damaging Het
Erc2 A T 14: 27,776,824 probably null Het
Fto G A 8: 91,441,807 probably null Het
Gdap1l1 C T 2: 163,446,091 P80S probably damaging Het
Gm1123 T C 9: 99,023,352 E35G possibly damaging Het
Hhipl1 A G 12: 108,321,897 probably benign Het
Ift80 A T 3: 68,914,675 L679Q probably damaging Het
Il18 A G 9: 50,576,713 probably benign Het
Inhbb T C 1: 119,417,395 Y388C probably damaging Het
Kmt2d G T 15: 98,844,479 probably benign Het
Krt20 A G 11: 99,437,814 V95A probably damaging Het
Lck A T 4: 129,555,681 S274R possibly damaging Het
Lrp1 T A 10: 127,540,979 N4243I probably damaging Het
Lrrfip2 G A 9: 111,214,243 V506I probably damaging Het
Ltbp2 A G 12: 84,793,733 C1000R probably damaging Het
Matn3 G A 12: 8,952,105 D106N probably damaging Het
Micalcl A G 7: 112,381,296 E49G probably benign Het
Mmadhc A G 2: 50,292,857 S36P probably damaging Het
Morn1 T C 4: 155,145,172 Y433H probably damaging Het
Mpo A G 11: 87,801,610 M525V probably benign Het
Myo5a C T 9: 75,161,492 R659C probably damaging Het
Obox6 T C 7: 15,834,439 S171G probably benign Het
Olfr1280 T A 2: 111,316,173 D231E probably benign Het
Olfr347 A G 2: 36,734,905 N195D probably damaging Het
Olfr998 A T 2: 85,591,352 N271Y probably benign Het
P2ry14 A G 3: 59,115,893 Y49H probably benign Het
Papss2 C T 19: 32,633,902 T17I possibly damaging Het
Pcid2 T C 8: 13,085,392 T206A probably benign Het
Pex6 A G 17: 46,711,918 E140G probably damaging Het
Ppp1r3b A G 8: 35,384,667 Y220C probably damaging Het
Prdx2 T G 8: 84,971,701 probably benign Het
Ptbp2 A T 3: 119,720,661 L471Q probably damaging Het
Rbm33 T A 5: 28,352,606 D232E possibly damaging Het
Rnf214 T A 9: 45,898,493 probably null Het
Rora G A 9: 69,374,048 R314H probably damaging Het
Rufy4 T C 1: 74,128,936 probably benign Het
Sag T C 1: 87,814,680 V58A probably damaging Het
Serpina3i C T 12: 104,265,164 T20M probably damaging Het
Slc4a5 A G 6: 83,277,555 N578S probably benign Het
Soat2 A G 15: 102,158,139 Y285C probably damaging Het
Syne4 G A 7: 30,318,919 G362E probably damaging Het
Tas2r126 A T 6: 42,435,102 M190L probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttc19 A G 11: 62,309,084 D218G probably damaging Het
Tut1 T C 19: 8,965,436 V629A probably damaging Het
Txndc11 T C 16: 11,088,104 N521D probably benign Het
Ushbp1 T C 8: 71,388,970 E405G possibly damaging Het
Usp46 C T 5: 74,003,257 R246Q probably benign Het
Utrn T C 10: 12,735,204 D469G probably damaging Het
Vmn2r104 T A 17: 20,041,813 I352F possibly damaging Het
Wdr4 G A 17: 31,496,916 T398I probably benign Het
Ythdc1 T A 5: 86,820,701 probably benign Het
Other mutations in Syk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01478:Syk APN 13 52624748 missense probably benign 0.00
IGL01522:Syk APN 13 52643061 missense probably benign
IGL01957:Syk APN 13 52631740 missense probably benign
IGL01962:Syk APN 13 52610957 missense probably damaging 1.00
IGL02613:Syk APN 13 52643040 missense probably damaging 0.97
IGL02824:Syk APN 13 52623283 splice site probably benign
IGL03130:Syk APN 13 52622732 missense probably benign 0.12
Apricot UTSW 13 52640733 missense probably damaging 1.00
poppy UTSW 13 52640733 missense probably damaging 1.00
Sisyphus UTSW 13 52640790 missense probably damaging 1.00
H8562:Syk UTSW 13 52640621 missense probably damaging 1.00
R0346:Syk UTSW 13 52640659 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1888:Syk UTSW 13 52640790 missense probably damaging 1.00
R1917:Syk UTSW 13 52622708 missense probably damaging 1.00
R2001:Syk UTSW 13 52611238 missense probably benign 0.21
R2919:Syk UTSW 13 52611121 missense probably benign
R3413:Syk UTSW 13 52631739 missense probably benign
R3695:Syk UTSW 13 52622765 splice site probably null
R4363:Syk UTSW 13 52640730 missense probably damaging 1.00
R4754:Syk UTSW 13 52612259 intron probably benign
R4755:Syk UTSW 13 52641986 missense probably benign 0.25
R4806:Syk UTSW 13 52632927 missense probably benign 0.14
R4817:Syk UTSW 13 52611206 missense probably benign 0.03
R4903:Syk UTSW 13 52611081 missense probably damaging 1.00
R4997:Syk UTSW 13 52612448 nonsense probably null
R5066:Syk UTSW 13 52641982 missense possibly damaging 0.49
R5114:Syk UTSW 13 52611035 missense probably damaging 1.00
R5267:Syk UTSW 13 52641926 missense probably benign 0.05
R5323:Syk UTSW 13 52631717 missense probably benign 0.00
R5705:Syk UTSW 13 52611047 missense probably benign 0.03
R6190:Syk UTSW 13 52611053 missense probably damaging 0.97
R6892:Syk UTSW 13 52632898 missense probably benign 0.00
R6932:Syk UTSW 13 52612459 splice site probably null
R6977:Syk UTSW 13 52633058 missense probably benign 0.00
R7496:Syk UTSW 13 52612416 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGCCGTCCACTCTTGGTAATG -3'
(R):5'- TGTTTCAAAGCAAGTTGACGCAAGC -3'

Posted On2013-04-11