Incidental Mutation 'R1812:Cntrl'
ID202440
Institutional Source Beutler Lab
Gene Symbol Cntrl
Ensembl Gene ENSMUSG00000057110
Gene Namecentriolin
Synonyms6720467O09Rik, Cep110, IB3/5, Ma2a8, b2b1468Clo, Cep1
MMRRC Submission 039840-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.645) question?
Stock #R1812 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location35109492-35178822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35149469 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 561 (V561M)
Ref Sequence ENSEMBL: ENSMUSP00000108657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028237] [ENSMUST00000113032] [ENSMUST00000113033] [ENSMUST00000113034] [ENSMUST00000113037] [ENSMUST00000156933] [ENSMUST00000201787]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028237
AA Change: V1114M

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028237
Gene: ENSMUSG00000057110
AA Change: V1114M

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 8e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.95e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.95e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113032
AA Change: V1113M

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108655
Gene: ENSMUSG00000057110
AA Change: V1113M

DomainStartEndE-ValueType
low complexity region 20 53 N/A INTRINSIC
coiled coil region 72 381 N/A INTRINSIC
coiled coil region 413 907 N/A INTRINSIC
low complexity region 945 960 N/A INTRINSIC
coiled coil region 989 1011 N/A INTRINSIC
low complexity region 1041 1059 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113033
SMART Domains Protein: ENSMUSP00000108656
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113034
AA Change: V561M

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108657
Gene: ENSMUSG00000057110
AA Change: V561M

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.68e-5 PROSPERO
coiled coil region 305 418 N/A INTRINSIC
low complexity region 422 442 N/A INTRINSIC
coiled coil region 445 549 N/A INTRINSIC
internal_repeat_1 566 579 1.52e-6 PROSPERO
internal_repeat_2 568 596 2.75e-5 PROSPERO
low complexity region 600 608 N/A INTRINSIC
internal_repeat_2 626 653 2.75e-5 PROSPERO
low complexity region 715 748 N/A INTRINSIC
coiled coil region 767 1076 N/A INTRINSIC
internal_repeat_3 1095 1112 5.68e-5 PROSPERO
low complexity region 1184 1224 N/A INTRINSIC
low complexity region 1344 1356 N/A INTRINSIC
low complexity region 1366 1388 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1421 1432 N/A INTRINSIC
low complexity region 1640 1655 N/A INTRINSIC
internal_repeat_1 1699 1712 1.52e-6 PROSPERO
low complexity region 1736 1754 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113037
AA Change: V560M

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108660
Gene: ENSMUSG00000057110
AA Change: V560M

DomainStartEndE-ValueType
coiled coil region 1 247 N/A INTRINSIC
internal_repeat_3 261 278 5.34e-5 PROSPERO
coiled coil region 305 548 N/A INTRINSIC
internal_repeat_1 565 578 1.42e-6 PROSPERO
internal_repeat_2 567 595 2.58e-5 PROSPERO
low complexity region 599 607 N/A INTRINSIC
internal_repeat_2 625 652 2.58e-5 PROSPERO
low complexity region 714 747 N/A INTRINSIC
coiled coil region 766 1075 N/A INTRINSIC
internal_repeat_3 1094 1111 5.34e-5 PROSPERO
low complexity region 1183 1223 N/A INTRINSIC
low complexity region 1343 1355 N/A INTRINSIC
low complexity region 1365 1387 N/A INTRINSIC
low complexity region 1399 1414 N/A INTRINSIC
low complexity region 1420 1431 N/A INTRINSIC
low complexity region 1639 1654 N/A INTRINSIC
internal_repeat_1 1698 1711 1.42e-6 PROSPERO
low complexity region 1735 1753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123884
SMART Domains Protein: ENSMUSP00000119760
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 37 400 N/A INTRINSIC
coiled coil region 458 571 N/A INTRINSIC
low complexity region 576 596 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000156933
AA Change: V1114M

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118731
Gene: ENSMUSG00000057110
AA Change: V1114M

DomainStartEndE-ValueType
low complexity region 21 38 N/A INTRINSIC
LRR 146 167 2.54e1 SMART
LRR 168 190 3.24e0 SMART
LRR 192 214 7.16e0 SMART
Blast:LRR 217 239 7e-6 BLAST
low complexity region 275 292 N/A INTRINSIC
coiled coil region 437 800 N/A INTRINSIC
coiled coil region 858 971 N/A INTRINSIC
low complexity region 975 995 N/A INTRINSIC
coiled coil region 998 1102 N/A INTRINSIC
internal_repeat_1 1119 1132 1.65e-5 PROSPERO
low complexity region 1153 1161 N/A INTRINSIC
low complexity region 1268 1301 N/A INTRINSIC
coiled coil region 1320 1629 N/A INTRINSIC
coiled coil region 1661 2155 N/A INTRINSIC
low complexity region 2193 2208 N/A INTRINSIC
internal_repeat_1 2252 2265 1.65e-5 PROSPERO
low complexity region 2289 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201787
SMART Domains Protein: ENSMUSP00000143914
Gene: ENSMUSG00000057110

DomainStartEndE-ValueType
coiled coil region 9 71 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein required for the centrosome to function as a microtubule organizing center. The gene product is also associated with centrosome maturation. One version of stem cell myeloproliferative disorder is the result of a reciprocal translocation between chromosomes 8 and 9, with the breakpoint associated with fibroblast growth factor receptor 1 and centrosomal protein 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit cardiac defects, including double outlet right ventricle, atrial septal defects, ventricular septal defects, tricuspid valve stenosis and heart right ventricle hypoplasia, and develop kidney cysts and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,257,457 Q545* probably null Het
Aadacl2 T C 3: 60,025,077 C338R probably damaging Het
Abcb4 G A 5: 8,928,578 probably null Het
Adam17 T C 12: 21,361,767 D41G probably damaging Het
Angptl7 T A 4: 148,498,083 I119F probably damaging Het
Arid1b T A 17: 5,337,029 S1586T probably benign Het
Arid4b C T 13: 14,195,429 A1170V probably damaging Het
Atad5 A G 11: 80,133,047 T1659A probably damaging Het
Bub1b T G 2: 118,632,421 D754E probably benign Het
Cdkn1a T C 17: 29,098,565 V53A probably benign Het
Chsy1 T G 7: 66,171,817 V600G probably benign Het
Col6a5 A G 9: 105,928,054 C1218R unknown Het
Crhr1 T C 11: 104,169,147 L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,170,388 probably null Het
Cyp3a59 A T 5: 146,102,811 Q298L probably damaging Het
Dctn1 A G 6: 83,192,518 E638G possibly damaging Het
Ddx41 A G 13: 55,535,954 I88T probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Dip2b C A 15: 100,198,938 probably null Het
Dscaml1 G A 9: 45,751,286 probably null Het
Dync1h1 C T 12: 110,662,900 A4246V possibly damaging Het
E330009J07Rik A G 6: 40,409,431 I288T probably benign Het
Epb41l1 T C 2: 156,496,511 I158T probably damaging Het
Fat1 A G 8: 45,036,803 Y3584C probably damaging Het
Fxyd5 T A 7: 31,037,930 probably null Het
Gapvd1 T A 2: 34,725,064 K336* probably null Het
Gm9637 G A 14: 19,402,395 noncoding transcript Het
Gpr65 C T 12: 98,275,742 T218M probably damaging Het
Gsdma3 T C 11: 98,632,393 V203A probably damaging Het
Helb T A 10: 120,089,566 K969* probably null Het
Hipk2 G A 6: 38,698,163 A1188V probably benign Het
Itpk1 T A 12: 102,574,058 E255D probably benign Het
Kif21a T C 15: 90,971,766 D596G possibly damaging Het
Kif5a A T 10: 127,242,010 I405N probably benign Het
Klk11 T A 7: 43,777,755 probably null Het
Luzp1 T A 4: 136,542,331 L622M probably benign Het
Macf1 T A 4: 123,432,024 I5227F probably damaging Het
Mapk10 A C 5: 102,913,262 S470A probably damaging Het
Morc2a C T 11: 3,685,831 T897I probably damaging Het
Nmbr A G 10: 14,760,539 probably null Het
Nosip T A 7: 45,076,574 M214K probably damaging Het
Olfr1136 A G 2: 87,693,103 F260L probably benign Het
Olfr159 G T 4: 43,770,230 Y260* probably null Het
Olfr553 A T 7: 102,614,370 N206K possibly damaging Het
Olfr569 T C 7: 102,888,078 Y25C probably benign Het
Pik3c2a A T 7: 116,417,664 V286E probably damaging Het
Ppfia4 T A 1: 134,324,573 I388F probably benign Het
Ppm1f A G 16: 16,917,787 H289R probably damaging Het
Ptprz1 T A 6: 22,959,712 D69E probably benign Het
Rad54b A T 4: 11,612,770 T801S probably damaging Het
Ramp1 A T 1: 91,196,857 N47Y probably damaging Het
Rnf32 T A 5: 29,206,260 H181Q possibly damaging Het
Rpa2 T C 4: 132,768,685 F6L probably benign Het
Ryr2 C A 13: 11,560,586 R4842L probably damaging Het
Scn11a G T 9: 119,780,865 C972* probably null Het
Setd2 C T 9: 110,550,102 T995I probably damaging Het
Slc39a7 A G 17: 34,028,815 L471P probably damaging Het
Slc6a21 C G 7: 45,282,947 S350R probably damaging Het
Slx4ip A G 2: 137,068,195 N300S probably benign Het
Spef2 G A 15: 9,679,349 P634L probably damaging Het
Stk32b G A 5: 37,466,758 A215V probably damaging Het
Svil A T 18: 5,097,545 Y1676F probably damaging Het
Tanc1 G A 2: 59,791,679 V381M probably damaging Het
Tanc2 T C 11: 105,886,386 F797L probably benign Het
Tas2r120 T G 6: 132,657,601 C215W probably benign Het
Tenm4 G A 7: 96,895,940 D2388N probably damaging Het
Thsd4 C T 9: 60,056,937 S64N probably damaging Het
Thsd7b C T 1: 129,758,610 R630C probably damaging Het
Top3a A G 11: 60,759,362 I145T probably damaging Het
Vmn2r78 A G 7: 86,920,787 D171G probably benign Het
Vmn2r82 A G 10: 79,379,212 E343G probably benign Het
Wdr70 T C 15: 8,079,179 D161G probably benign Het
Other mutations in Cntrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cntrl APN 2 35137814 splice site probably benign
IGL00478:Cntrl APN 2 35160601 missense probably damaging 0.98
IGL01460:Cntrl APN 2 35165844 missense probably benign 0.04
IGL01556:Cntrl APN 2 35173059 missense probably benign 0.19
IGL02155:Cntrl APN 2 35160238 splice site probably benign
IGL02419:Cntrl APN 2 35134043 missense probably damaging 0.97
R0179:Cntrl UTSW 2 35167859 missense probably benign 0.00
R0276:Cntrl UTSW 2 35151732 missense possibly damaging 0.62
R0471:Cntrl UTSW 2 35127380 missense probably benign 0.41
R0755:Cntrl UTSW 2 35145139 missense probably damaging 1.00
R0763:Cntrl UTSW 2 35171066 missense probably benign
R0781:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R0791:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0792:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R0801:Cntrl UTSW 2 35175095 splice site probably benign
R1067:Cntrl UTSW 2 35149022 unclassified probably benign
R1110:Cntrl UTSW 2 35160627 missense possibly damaging 0.66
R1117:Cntrl UTSW 2 35127973 missense probably damaging 1.00
R1457:Cntrl UTSW 2 35122756 missense probably benign 0.00
R1472:Cntrl UTSW 2 35169317 critical splice donor site probably null
R1522:Cntrl UTSW 2 35155279 missense possibly damaging 0.83
R1702:Cntrl UTSW 2 35171836 critical splice acceptor site probably null
R1762:Cntrl UTSW 2 35122806 frame shift probably null
R1785:Cntrl UTSW 2 35122806 frame shift probably null
R1786:Cntrl UTSW 2 35122806 frame shift probably null
R1854:Cntrl UTSW 2 35122684 missense probably damaging 1.00
R1863:Cntrl UTSW 2 35118119 missense possibly damaging 0.93
R1868:Cntrl UTSW 2 35129815 missense probably benign 0.03
R1914:Cntrl UTSW 2 35162861 missense probably benign 0.04
R1915:Cntrl UTSW 2 35162861 missense probably benign 0.04
R2049:Cntrl UTSW 2 35122806 frame shift probably null
R2118:Cntrl UTSW 2 35161965 missense probably benign 0.31
R2140:Cntrl UTSW 2 35122806 frame shift probably null
R2142:Cntrl UTSW 2 35122806 frame shift probably null
R2203:Cntrl UTSW 2 35143737 missense possibly damaging 0.84
R2300:Cntrl UTSW 2 35127513 missense probably benign 0.00
R2349:Cntrl UTSW 2 35176251 missense probably benign 0.18
R2374:Cntrl UTSW 2 35153276 missense possibly damaging 0.46
R3429:Cntrl UTSW 2 35145100 missense probably damaging 1.00
R3890:Cntrl UTSW 2 35170480 missense probably benign 0.02
R3911:Cntrl UTSW 2 35120049 missense probably damaging 1.00
R3922:Cntrl UTSW 2 35129739 missense probably damaging 0.98
R4081:Cntrl UTSW 2 35161926 splice site probably benign
R4081:Cntrl UTSW 2 35175125 missense probably damaging 1.00
R4516:Cntrl UTSW 2 35127981 missense probably benign 0.00
R4518:Cntrl UTSW 2 35148974 missense probably damaging 1.00
R4519:Cntrl UTSW 2 35173111 missense probably damaging 1.00
R4646:Cntrl UTSW 2 35149461 missense probably damaging 0.99
R4753:Cntrl UTSW 2 35153439 missense possibly damaging 0.90
R4763:Cntrl UTSW 2 35175551 missense probably damaging 1.00
R4916:Cntrl UTSW 2 35165682 missense probably benign 0.42
R5168:Cntrl UTSW 2 35157655 missense probably damaging 1.00
R5291:Cntrl UTSW 2 35134060 missense probably damaging 1.00
R5356:Cntrl UTSW 2 35148899 nonsense probably null
R5774:Cntrl UTSW 2 35162861 missense probably benign 0.15
R5947:Cntrl UTSW 2 35116679 missense probably damaging 1.00
R6144:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6147:Cntrl UTSW 2 35165733 missense possibly damaging 0.93
R6214:Cntrl UTSW 2 35129634 missense probably benign 0.10
R6267:Cntrl UTSW 2 35129793 missense probably damaging 1.00
R6332:Cntrl UTSW 2 35128024 missense possibly damaging 0.78
R6445:Cntrl UTSW 2 35162848 missense probably benign 0.05
R6487:Cntrl UTSW 2 35122682 missense possibly damaging 0.89
R6497:Cntrl UTSW 2 35135572 missense possibly damaging 0.66
R6782:Cntrl UTSW 2 35170646 missense possibly damaging 0.75
R6815:Cntrl UTSW 2 35149491 missense probably damaging 1.00
R6853:Cntrl UTSW 2 35129821 missense possibly damaging 0.87
R6858:Cntrl UTSW 2 35162095 critical splice donor site probably null
R6965:Cntrl UTSW 2 35162833 missense probably benign 0.20
R6970:Cntrl UTSW 2 35118137 missense probably benign
X0024:Cntrl UTSW 2 35147296 missense probably damaging 1.00
X0026:Cntrl UTSW 2 35149516 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35157768 missense probably damaging 1.00
X0027:Cntrl UTSW 2 35165682 missense probably benign 0.08
X0028:Cntrl UTSW 2 35147344 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CTAGGGGATTTGATTTTAGCAAGAC -3'
(R):5'- GCACCTGCTAACAAATTTGGGG -3'

Sequencing Primer
(F):5'- TCGATGGACAGAAAGATGTTTTC -3'
(R):5'- CCTGCTAACAAATTTGGGGAAGGAG -3'
Posted On2014-06-23