Incidental Mutation 'R1812:Aadacl2'
ID202447
Institutional Source Beutler Lab
Gene Symbol Aadacl2
Ensembl Gene ENSMUSG00000091376
Gene Namearylacetamide deacetylase like 2
SynonymsEG639634
MMRRC Submission 039840-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R1812 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location60006743-60025420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60025077 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 338 (C338R)
Ref Sequence ENSEMBL: ENSMUSP00000129444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169794]
Predicted Effect probably damaging
Transcript: ENSMUST00000169794
AA Change: C338R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129444
Gene: ENSMUSG00000091376
AA Change: C338R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:COesterase 91 219 2.7e-7 PFAM
Pfam:Abhydrolase_3 107 272 8.2e-38 PFAM
Pfam:Abhydrolase_3 270 375 3.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195422
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,257,457 Q545* probably null Het
Abcb4 G A 5: 8,928,578 probably null Het
Adam17 T C 12: 21,361,767 D41G probably damaging Het
Angptl7 T A 4: 148,498,083 I119F probably damaging Het
Arid1b T A 17: 5,337,029 S1586T probably benign Het
Arid4b C T 13: 14,195,429 A1170V probably damaging Het
Atad5 A G 11: 80,133,047 T1659A probably damaging Het
Bub1b T G 2: 118,632,421 D754E probably benign Het
Cdkn1a T C 17: 29,098,565 V53A probably benign Het
Chsy1 T G 7: 66,171,817 V600G probably benign Het
Cntrl G A 2: 35,149,469 V561M probably damaging Het
Col6a5 A G 9: 105,928,054 C1218R unknown Het
Crhr1 T C 11: 104,169,147 L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,170,388 probably null Het
Cyp3a59 A T 5: 146,102,811 Q298L probably damaging Het
Dctn1 A G 6: 83,192,518 E638G possibly damaging Het
Ddx41 A G 13: 55,535,954 I88T probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Dip2b C A 15: 100,198,938 probably null Het
Dscaml1 G A 9: 45,751,286 probably null Het
Dync1h1 C T 12: 110,662,900 A4246V possibly damaging Het
E330009J07Rik A G 6: 40,409,431 I288T probably benign Het
Epb41l1 T C 2: 156,496,511 I158T probably damaging Het
Fat1 A G 8: 45,036,803 Y3584C probably damaging Het
Fxyd5 T A 7: 31,037,930 probably null Het
Gapvd1 T A 2: 34,725,064 K336* probably null Het
Gm9637 G A 14: 19,402,395 noncoding transcript Het
Gpr65 C T 12: 98,275,742 T218M probably damaging Het
Gsdma3 T C 11: 98,632,393 V203A probably damaging Het
Helb T A 10: 120,089,566 K969* probably null Het
Hipk2 G A 6: 38,698,163 A1188V probably benign Het
Itpk1 T A 12: 102,574,058 E255D probably benign Het
Kif21a T C 15: 90,971,766 D596G possibly damaging Het
Kif5a A T 10: 127,242,010 I405N probably benign Het
Klk11 T A 7: 43,777,755 probably null Het
Luzp1 T A 4: 136,542,331 L622M probably benign Het
Macf1 T A 4: 123,432,024 I5227F probably damaging Het
Mapk10 A C 5: 102,913,262 S470A probably damaging Het
Morc2a C T 11: 3,685,831 T897I probably damaging Het
Nmbr A G 10: 14,760,539 probably null Het
Nosip T A 7: 45,076,574 M214K probably damaging Het
Olfr1136 A G 2: 87,693,103 F260L probably benign Het
Olfr159 G T 4: 43,770,230 Y260* probably null Het
Olfr553 A T 7: 102,614,370 N206K possibly damaging Het
Olfr569 T C 7: 102,888,078 Y25C probably benign Het
Pik3c2a A T 7: 116,417,664 V286E probably damaging Het
Ppfia4 T A 1: 134,324,573 I388F probably benign Het
Ppm1f A G 16: 16,917,787 H289R probably damaging Het
Ptprz1 T A 6: 22,959,712 D69E probably benign Het
Rad54b A T 4: 11,612,770 T801S probably damaging Het
Ramp1 A T 1: 91,196,857 N47Y probably damaging Het
Rnf32 T A 5: 29,206,260 H181Q possibly damaging Het
Rpa2 T C 4: 132,768,685 F6L probably benign Het
Ryr2 C A 13: 11,560,586 R4842L probably damaging Het
Scn11a G T 9: 119,780,865 C972* probably null Het
Setd2 C T 9: 110,550,102 T995I probably damaging Het
Slc39a7 A G 17: 34,028,815 L471P probably damaging Het
Slc6a21 C G 7: 45,282,947 S350R probably damaging Het
Slx4ip A G 2: 137,068,195 N300S probably benign Het
Spef2 G A 15: 9,679,349 P634L probably damaging Het
Stk32b G A 5: 37,466,758 A215V probably damaging Het
Svil A T 18: 5,097,545 Y1676F probably damaging Het
Tanc1 G A 2: 59,791,679 V381M probably damaging Het
Tanc2 T C 11: 105,886,386 F797L probably benign Het
Tas2r120 T G 6: 132,657,601 C215W probably benign Het
Tenm4 G A 7: 96,895,940 D2388N probably damaging Het
Thsd4 C T 9: 60,056,937 S64N probably damaging Het
Thsd7b C T 1: 129,758,610 R630C probably damaging Het
Top3a A G 11: 60,759,362 I145T probably damaging Het
Vmn2r78 A G 7: 86,920,787 D171G probably benign Het
Vmn2r82 A G 10: 79,379,212 E343G probably benign Het
Wdr70 T C 15: 8,079,179 D161G probably benign Het
Other mutations in Aadacl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Aadacl2 APN 3 60024676 missense probably benign
IGL01626:Aadacl2 APN 3 60019174 missense probably damaging 1.00
IGL01777:Aadacl2 APN 3 60024784 missense possibly damaging 0.61
IGL02189:Aadacl2 APN 3 60025188 missense probably damaging 0.99
IGL03238:Aadacl2 APN 3 60024918 missense probably benign 0.31
R0369:Aadacl2 UTSW 3 60024722 nonsense probably null
R0540:Aadacl2 UTSW 3 60019206 missense possibly damaging 0.50
R1440:Aadacl2 UTSW 3 60024892 missense probably damaging 0.99
R1589:Aadacl2 UTSW 3 60010576 missense probably benign 0.00
R1778:Aadacl2 UTSW 3 60017450 splice site probably null
R1781:Aadacl2 UTSW 3 60024696 missense probably damaging 1.00
R2411:Aadacl2 UTSW 3 60017423 missense possibly damaging 0.94
R4622:Aadacl2 UTSW 3 60007053 missense probably damaging 1.00
R4698:Aadacl2 UTSW 3 60025039 missense probably benign 0.00
R5326:Aadacl2 UTSW 3 60025063 missense probably damaging 1.00
R5542:Aadacl2 UTSW 3 60025063 missense probably damaging 1.00
R6314:Aadacl2 UTSW 3 60017403 missense probably damaging 1.00
R6469:Aadacl2 UTSW 3 60024789 missense probably benign 0.24
R6953:Aadacl2 UTSW 3 60024760 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ACTTCCACAGGCAATGAGAA -3'
(R):5'- CCAGCCAACTAACATACATATCTTTTA -3'

Sequencing Primer
(F):5'- GAGTCCAGACATCTCTTCAGG -3'
(R):5'- ATCCTCAGCCCTAGATCTAAGTG -3'
Posted On2014-06-23