Incidental Mutation 'R1812:Slc6a21'
ID202469
Institutional Source Beutler Lab
Gene Symbol Slc6a21
Ensembl Gene ENSMUSG00000070568
Gene Namesolute carrier family 6 member 21
Synonyms1700039E15Rik
MMRRC Submission 039840-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.021) question?
Stock #R1812 (G1)
Quality Score148
Status Not validated
Chromosome7
Chromosomal Location45277513-45288998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 45282947 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 350 (S350R)
Ref Sequence ENSEMBL: ENSMUSP00000147890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085364] [ENSMUST00000210861]
Predicted Effect probably damaging
Transcript: ENSMUST00000085364
AA Change: S25R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000082476
Gene: ENSMUSG00000070568
AA Change: S25R

DomainStartEndE-ValueType
Pfam:SNF 1 306 8.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176276
AA Change: S350R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000135707
Gene: ENSMUSG00000070568
AA Change: S350R

DomainStartEndE-ValueType
Pfam:SNF 48 631 2e-103 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209477
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209886
Predicted Effect unknown
Transcript: ENSMUST00000210207
AA Change: S57R
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210733
Predicted Effect probably damaging
Transcript: ENSMUST00000210861
AA Change: S350R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,257,457 Q545* probably null Het
Aadacl2 T C 3: 60,025,077 C338R probably damaging Het
Abcb4 G A 5: 8,928,578 probably null Het
Adam17 T C 12: 21,361,767 D41G probably damaging Het
Angptl7 T A 4: 148,498,083 I119F probably damaging Het
Arid1b T A 17: 5,337,029 S1586T probably benign Het
Arid4b C T 13: 14,195,429 A1170V probably damaging Het
Atad5 A G 11: 80,133,047 T1659A probably damaging Het
Bub1b T G 2: 118,632,421 D754E probably benign Het
Cdkn1a T C 17: 29,098,565 V53A probably benign Het
Chsy1 T G 7: 66,171,817 V600G probably benign Het
Cntrl G A 2: 35,149,469 V561M probably damaging Het
Col6a5 A G 9: 105,928,054 C1218R unknown Het
Crhr1 T C 11: 104,169,147 L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,170,388 probably null Het
Cyp3a59 A T 5: 146,102,811 Q298L probably damaging Het
Dctn1 A G 6: 83,192,518 E638G possibly damaging Het
Ddx41 A G 13: 55,535,954 I88T probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Dip2b C A 15: 100,198,938 probably null Het
Dscaml1 G A 9: 45,751,286 probably null Het
Dync1h1 C T 12: 110,662,900 A4246V possibly damaging Het
E330009J07Rik A G 6: 40,409,431 I288T probably benign Het
Epb41l1 T C 2: 156,496,511 I158T probably damaging Het
Fat1 A G 8: 45,036,803 Y3584C probably damaging Het
Fxyd5 T A 7: 31,037,930 probably null Het
Gapvd1 T A 2: 34,725,064 K336* probably null Het
Gm9637 G A 14: 19,402,395 noncoding transcript Het
Gpr65 C T 12: 98,275,742 T218M probably damaging Het
Gsdma3 T C 11: 98,632,393 V203A probably damaging Het
Helb T A 10: 120,089,566 K969* probably null Het
Hipk2 G A 6: 38,698,163 A1188V probably benign Het
Itpk1 T A 12: 102,574,058 E255D probably benign Het
Kif21a T C 15: 90,971,766 D596G possibly damaging Het
Kif5a A T 10: 127,242,010 I405N probably benign Het
Klk11 T A 7: 43,777,755 probably null Het
Luzp1 T A 4: 136,542,331 L622M probably benign Het
Macf1 T A 4: 123,432,024 I5227F probably damaging Het
Mapk10 A C 5: 102,913,262 S470A probably damaging Het
Morc2a C T 11: 3,685,831 T897I probably damaging Het
Nmbr A G 10: 14,760,539 probably null Het
Nosip T A 7: 45,076,574 M214K probably damaging Het
Olfr1136 A G 2: 87,693,103 F260L probably benign Het
Olfr159 G T 4: 43,770,230 Y260* probably null Het
Olfr553 A T 7: 102,614,370 N206K possibly damaging Het
Olfr569 T C 7: 102,888,078 Y25C probably benign Het
Pik3c2a A T 7: 116,417,664 V286E probably damaging Het
Ppfia4 T A 1: 134,324,573 I388F probably benign Het
Ppm1f A G 16: 16,917,787 H289R probably damaging Het
Ptprz1 T A 6: 22,959,712 D69E probably benign Het
Rad54b A T 4: 11,612,770 T801S probably damaging Het
Ramp1 A T 1: 91,196,857 N47Y probably damaging Het
Rnf32 T A 5: 29,206,260 H181Q possibly damaging Het
Rpa2 T C 4: 132,768,685 F6L probably benign Het
Ryr2 C A 13: 11,560,586 R4842L probably damaging Het
Scn11a G T 9: 119,780,865 C972* probably null Het
Setd2 C T 9: 110,550,102 T995I probably damaging Het
Slc39a7 A G 17: 34,028,815 L471P probably damaging Het
Slx4ip A G 2: 137,068,195 N300S probably benign Het
Spef2 G A 15: 9,679,349 P634L probably damaging Het
Stk32b G A 5: 37,466,758 A215V probably damaging Het
Svil A T 18: 5,097,545 Y1676F probably damaging Het
Tanc1 G A 2: 59,791,679 V381M probably damaging Het
Tanc2 T C 11: 105,886,386 F797L probably benign Het
Tas2r120 T G 6: 132,657,601 C215W probably benign Het
Tenm4 G A 7: 96,895,940 D2388N probably damaging Het
Thsd4 C T 9: 60,056,937 S64N probably damaging Het
Thsd7b C T 1: 129,758,610 R630C probably damaging Het
Top3a A G 11: 60,759,362 I145T probably damaging Het
Vmn2r78 A G 7: 86,920,787 D171G probably benign Het
Vmn2r82 A G 10: 79,379,212 E343G probably benign Het
Wdr70 T C 15: 8,079,179 D161G probably benign Het
Other mutations in Slc6a21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Slc6a21 APN 7 45288244 missense probably benign 0.31
IGL01526:Slc6a21 APN 7 45287796 missense probably damaging 1.00
IGL01670:Slc6a21 APN 7 45288133 missense possibly damaging 0.91
IGL01975:Slc6a21 APN 7 45287851 missense probably benign 0.28
IGL02064:Slc6a21 APN 7 45286459 missense possibly damaging 0.71
IGL02441:Slc6a21 APN 7 45288081 missense probably damaging 1.00
IGL02735:Slc6a21 APN 7 45286637 splice site probably benign
IGL03097:Slc6a21 UTSW 7 45288168 nonsense probably null
R0211:Slc6a21 UTSW 7 45288243 missense possibly damaging 0.90
R0211:Slc6a21 UTSW 7 45288243 missense possibly damaging 0.90
R0269:Slc6a21 UTSW 7 45286908 nonsense probably null
R0336:Slc6a21 UTSW 7 45286468 missense probably damaging 1.00
R1077:Slc6a21 UTSW 7 45288202 missense probably benign 0.42
R1476:Slc6a21 UTSW 7 45272628 missense probably benign 0.09
R1763:Slc6a21 UTSW 7 45287734 nonsense probably null
R1792:Slc6a21 UTSW 7 45280731 missense probably benign 0.04
R1796:Slc6a21 UTSW 7 45280755 missense probably damaging 1.00
R1868:Slc6a21 UTSW 7 45287828 missense probably benign 0.13
R2121:Slc6a21 UTSW 7 45288462 missense probably benign 0.04
R2129:Slc6a21 UTSW 7 45282773 unclassified probably null
R2294:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R2295:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R2409:Slc6a21 UTSW 7 45280326 missense probably benign 0.15
R2858:Slc6a21 UTSW 7 45280528 missense possibly damaging 0.83
R3498:Slc6a21 UTSW 7 45280842 missense probably damaging 1.00
R3751:Slc6a21 UTSW 7 45280504 missense probably benign
R4297:Slc6a21 UTSW 7 45287762 missense possibly damaging 0.95
R4510:Slc6a21 UTSW 7 45287289 missense probably damaging 1.00
R4511:Slc6a21 UTSW 7 45287289 missense probably damaging 1.00
R4876:Slc6a21 UTSW 7 45280111 nonsense probably null
R4921:Slc6a21 UTSW 7 45288310 missense possibly damaging 0.53
R5485:Slc6a21 UTSW 7 45282542 critical splice donor site probably null
R5559:Slc6a21 UTSW 7 45288429 missense possibly damaging 0.61
R6305:Slc6a21 UTSW 7 45280604 missense possibly damaging 0.88
R6390:Slc6a21 UTSW 7 45287002 missense probably benign 0.02
R6571:Slc6a21 UTSW 7 45280879 missense probably damaging 0.99
R6792:Slc6a21 UTSW 7 45279885 start codon destroyed probably null 0.02
Predicted Primers PCR Primer
(F):5'- TGGAGGCCATGTTCTCTACTC -3'
(R):5'- ATGCCAACAACTGCTTCCG -3'

Sequencing Primer
(F):5'- TACTCCCTCGGCCTCGG -3'
(R):5'- AGTGGCCAGCAAGCTCTG -3'
Posted On2014-06-23