Incidental Mutation 'R1812:1700017B05Rik'
ID202481
Institutional Source Beutler Lab
Gene Symbol 1700017B05Rik
Ensembl Gene ENSMUSG00000032300
Gene NameRIKEN cDNA 1700017B05 gene
SynonymsD9Ertd278e
MMRRC Submission 039840-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R1812 (G1)
Quality Score193
Status Not validated
Chromosome9
Chromosomal Location57253117-57262612 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 57257457 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 545 (Q545*)
Ref Sequence ENSEMBL: ENSMUSP00000150884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034846] [ENSMUST00000213199] [ENSMUST00000215298] [ENSMUST00000217657]
Predicted Effect probably null
Transcript: ENSMUST00000034846
AA Change: Q545*
SMART Domains Protein: ENSMUSP00000034846
Gene: ENSMUSG00000032300
AA Change: Q545*

DomainStartEndE-ValueType
low complexity region 265 284 N/A INTRINSIC
low complexity region 293 299 N/A INTRINSIC
low complexity region 334 347 N/A INTRINSIC
low complexity region 649 675 N/A INTRINSIC
low complexity region 692 728 N/A INTRINSIC
low complexity region 785 799 N/A INTRINSIC
low complexity region 933 951 N/A INTRINSIC
low complexity region 963 977 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000213199
AA Change: Q545*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214583
Predicted Effect probably benign
Transcript: ENSMUST00000215298
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215426
Predicted Effect probably benign
Transcript: ENSMUST00000217657
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2 T C 3: 60,025,077 C338R probably damaging Het
Abcb4 G A 5: 8,928,578 probably null Het
Adam17 T C 12: 21,361,767 D41G probably damaging Het
Angptl7 T A 4: 148,498,083 I119F probably damaging Het
Arid1b T A 17: 5,337,029 S1586T probably benign Het
Arid4b C T 13: 14,195,429 A1170V probably damaging Het
Atad5 A G 11: 80,133,047 T1659A probably damaging Het
Bub1b T G 2: 118,632,421 D754E probably benign Het
Cdkn1a T C 17: 29,098,565 V53A probably benign Het
Chsy1 T G 7: 66,171,817 V600G probably benign Het
Cntrl G A 2: 35,149,469 V561M probably damaging Het
Col6a5 A G 9: 105,928,054 C1218R unknown Het
Crhr1 T C 11: 104,169,147 L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,170,388 probably null Het
Cyp3a59 A T 5: 146,102,811 Q298L probably damaging Het
Dctn1 A G 6: 83,192,518 E638G possibly damaging Het
Ddx41 A G 13: 55,535,954 I88T probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Dip2b C A 15: 100,198,938 probably null Het
Dscaml1 G A 9: 45,751,286 probably null Het
Dync1h1 C T 12: 110,662,900 A4246V possibly damaging Het
E330009J07Rik A G 6: 40,409,431 I288T probably benign Het
Epb41l1 T C 2: 156,496,511 I158T probably damaging Het
Fat1 A G 8: 45,036,803 Y3584C probably damaging Het
Fxyd5 T A 7: 31,037,930 probably null Het
Gapvd1 T A 2: 34,725,064 K336* probably null Het
Gm9637 G A 14: 19,402,395 noncoding transcript Het
Gpr65 C T 12: 98,275,742 T218M probably damaging Het
Gsdma3 T C 11: 98,632,393 V203A probably damaging Het
Helb T A 10: 120,089,566 K969* probably null Het
Hipk2 G A 6: 38,698,163 A1188V probably benign Het
Itpk1 T A 12: 102,574,058 E255D probably benign Het
Kif21a T C 15: 90,971,766 D596G possibly damaging Het
Kif5a A T 10: 127,242,010 I405N probably benign Het
Klk11 T A 7: 43,777,755 probably null Het
Luzp1 T A 4: 136,542,331 L622M probably benign Het
Macf1 T A 4: 123,432,024 I5227F probably damaging Het
Mapk10 A C 5: 102,913,262 S470A probably damaging Het
Morc2a C T 11: 3,685,831 T897I probably damaging Het
Nmbr A G 10: 14,760,539 probably null Het
Nosip T A 7: 45,076,574 M214K probably damaging Het
Olfr1136 A G 2: 87,693,103 F260L probably benign Het
Olfr159 G T 4: 43,770,230 Y260* probably null Het
Olfr553 A T 7: 102,614,370 N206K possibly damaging Het
Olfr569 T C 7: 102,888,078 Y25C probably benign Het
Pik3c2a A T 7: 116,417,664 V286E probably damaging Het
Ppfia4 T A 1: 134,324,573 I388F probably benign Het
Ppm1f A G 16: 16,917,787 H289R probably damaging Het
Ptprz1 T A 6: 22,959,712 D69E probably benign Het
Rad54b A T 4: 11,612,770 T801S probably damaging Het
Ramp1 A T 1: 91,196,857 N47Y probably damaging Het
Rnf32 T A 5: 29,206,260 H181Q possibly damaging Het
Rpa2 T C 4: 132,768,685 F6L probably benign Het
Ryr2 C A 13: 11,560,586 R4842L probably damaging Het
Scn11a G T 9: 119,780,865 C972* probably null Het
Setd2 C T 9: 110,550,102 T995I probably damaging Het
Slc39a7 A G 17: 34,028,815 L471P probably damaging Het
Slc6a21 C G 7: 45,282,947 S350R probably damaging Het
Slx4ip A G 2: 137,068,195 N300S probably benign Het
Spef2 G A 15: 9,679,349 P634L probably damaging Het
Stk32b G A 5: 37,466,758 A215V probably damaging Het
Svil A T 18: 5,097,545 Y1676F probably damaging Het
Tanc1 G A 2: 59,791,679 V381M probably damaging Het
Tanc2 T C 11: 105,886,386 F797L probably benign Het
Tas2r120 T G 6: 132,657,601 C215W probably benign Het
Tenm4 G A 7: 96,895,940 D2388N probably damaging Het
Thsd4 C T 9: 60,056,937 S64N probably damaging Het
Thsd7b C T 1: 129,758,610 R630C probably damaging Het
Top3a A G 11: 60,759,362 I145T probably damaging Het
Vmn2r78 A G 7: 86,920,787 D171G probably benign Het
Vmn2r82 A G 10: 79,379,212 E343G probably benign Het
Wdr70 T C 15: 8,079,179 D161G probably benign Het
Other mutations in 1700017B05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:1700017B05Rik APN 9 57258246 missense probably damaging 1.00
IGL01287:1700017B05Rik APN 9 57257757 missense probably damaging 1.00
IGL01798:1700017B05Rik APN 9 57256638 missense probably benign 0.10
IGL01933:1700017B05Rik APN 9 57257367 missense possibly damaging 0.95
IGL02146:1700017B05Rik APN 9 57256740 missense possibly damaging 0.82
IGL02158:1700017B05Rik APN 9 57256619 unclassified probably null
IGL02277:1700017B05Rik APN 9 57258425 missense probably benign 0.05
IGL02707:1700017B05Rik APN 9 57258645 missense probably benign
IGL02887:1700017B05Rik APN 9 57258885 missense probably damaging 1.00
IGL02936:1700017B05Rik APN 9 57258404 missense possibly damaging 0.69
R0583:1700017B05Rik UTSW 9 57257643 missense probably benign 0.04
R0926:1700017B05Rik UTSW 9 57257549 missense probably damaging 0.99
R1903:1700017B05Rik UTSW 9 57258352 missense possibly damaging 0.69
R4542:1700017B05Rik UTSW 9 57256592 missense probably damaging 1.00
R4596:1700017B05Rik UTSW 9 57257805 missense probably benign 0.03
R4631:1700017B05Rik UTSW 9 57257987 missense probably damaging 1.00
R4869:1700017B05Rik UTSW 9 57254205 missense probably damaging 1.00
R5265:1700017B05Rik UTSW 9 57258894 missense probably damaging 1.00
R5361:1700017B05Rik UTSW 9 57257185 missense probably damaging 1.00
R6216:1700017B05Rik UTSW 9 57257627 missense probably benign 0.33
R6356:1700017B05Rik UTSW 9 57254009 missense probably benign 0.11
R6579:1700017B05Rik UTSW 9 57254224 missense possibly damaging 0.89
R6774:1700017B05Rik UTSW 9 57256625 missense probably damaging 1.00
R6921:1700017B05Rik UTSW 9 57258736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTGACACTGTGTTTTCTATAC -3'
(R):5'- TGTTATCCGGGACAGTCCAG -3'

Sequencing Primer
(F):5'- GACACTGTGTTTTCTATACCTGGC -3'
(R):5'- TGTCCCACAGAAGGATGCCAG -3'
Posted On2014-06-23