Incidental Mutation 'R1812:Thsd4'
ID202482
Institutional Source Beutler Lab
Gene Symbol Thsd4
Ensembl Gene ENSMUSG00000032289
Gene Namethrombospondin, type I, domain containing 4
SynonymsADAMTSL6, B230114P05Rik
MMRRC Submission 039840-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #R1812 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location59966931-60522046 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60056937 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 64 (S64N)
Ref Sequence ENSEMBL: ENSMUSP00000034829 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034829] [ENSMUST00000098660] [ENSMUST00000171654]
Predicted Effect probably damaging
Transcript: ENSMUST00000034829
AA Change: S64N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034829
Gene: ENSMUSG00000032289
AA Change: S64N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ADAM_spacer1 52 168 7.8e-40 PFAM
low complexity region 189 205 N/A INTRINSIC
TSP1 261 317 1.51e-1 SMART
TSP1 319 377 8.11e-5 SMART
TSP1 379 434 7.92e-8 SMART
TSP1 436 491 1.6e-3 SMART
TSP1 495 553 4.82e-2 SMART
TSP1 556 608 1.03e-6 SMART
Pfam:PLAC 614 646 2.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098660
AA Change: S424N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000096257
Gene: ENSMUSG00000032289
AA Change: S424N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
TSP1 57 100 7.9e-2 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Pfam:ADAM_spacer1 412 528 1.5e-39 PFAM
low complexity region 549 565 N/A INTRINSIC
TSP1 621 677 1.51e-1 SMART
TSP1 679 737 8.11e-5 SMART
TSP1 739 794 7.92e-8 SMART
TSP1 796 851 1.6e-3 SMART
TSP1 855 913 4.82e-2 SMART
TSP1 916 968 1.03e-6 SMART
Pfam:PLAC 974 1006 4.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171654
AA Change: S424N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000131418
Gene: ENSMUSG00000032289
AA Change: S424N

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
TSP1 57 100 7.9e-2 SMART
low complexity region 160 175 N/A INTRINSIC
low complexity region 187 202 N/A INTRINSIC
Pfam:ADAM_spacer1 412 528 5.4e-40 PFAM
low complexity region 549 565 N/A INTRINSIC
TSP1 621 677 1.51e-1 SMART
TSP1 679 737 8.11e-5 SMART
TSP1 739 794 7.92e-8 SMART
TSP1 796 851 1.6e-3 SMART
TSP1 855 913 4.82e-2 SMART
TSP1 916 968 1.03e-6 SMART
Pfam:PLAC 975 1005 1.3e-12 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,257,457 Q545* probably null Het
Aadacl2 T C 3: 60,025,077 C338R probably damaging Het
Abcb4 G A 5: 8,928,578 probably null Het
Adam17 T C 12: 21,361,767 D41G probably damaging Het
Angptl7 T A 4: 148,498,083 I119F probably damaging Het
Arid1b T A 17: 5,337,029 S1586T probably benign Het
Arid4b C T 13: 14,195,429 A1170V probably damaging Het
Atad5 A G 11: 80,133,047 T1659A probably damaging Het
Bub1b T G 2: 118,632,421 D754E probably benign Het
Cdkn1a T C 17: 29,098,565 V53A probably benign Het
Chsy1 T G 7: 66,171,817 V600G probably benign Het
Cntrl G A 2: 35,149,469 V561M probably damaging Het
Col6a5 A G 9: 105,928,054 C1218R unknown Het
Crhr1 T C 11: 104,169,147 L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,170,388 probably null Het
Cyp3a59 A T 5: 146,102,811 Q298L probably damaging Het
Dctn1 A G 6: 83,192,518 E638G possibly damaging Het
Ddx41 A G 13: 55,535,954 I88T probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Dip2b C A 15: 100,198,938 probably null Het
Dscaml1 G A 9: 45,751,286 probably null Het
Dync1h1 C T 12: 110,662,900 A4246V possibly damaging Het
E330009J07Rik A G 6: 40,409,431 I288T probably benign Het
Epb41l1 T C 2: 156,496,511 I158T probably damaging Het
Fat1 A G 8: 45,036,803 Y3584C probably damaging Het
Fxyd5 T A 7: 31,037,930 probably null Het
Gapvd1 T A 2: 34,725,064 K336* probably null Het
Gm9637 G A 14: 19,402,395 noncoding transcript Het
Gpr65 C T 12: 98,275,742 T218M probably damaging Het
Gsdma3 T C 11: 98,632,393 V203A probably damaging Het
Helb T A 10: 120,089,566 K969* probably null Het
Hipk2 G A 6: 38,698,163 A1188V probably benign Het
Itpk1 T A 12: 102,574,058 E255D probably benign Het
Kif21a T C 15: 90,971,766 D596G possibly damaging Het
Kif5a A T 10: 127,242,010 I405N probably benign Het
Klk11 T A 7: 43,777,755 probably null Het
Luzp1 T A 4: 136,542,331 L622M probably benign Het
Macf1 T A 4: 123,432,024 I5227F probably damaging Het
Mapk10 A C 5: 102,913,262 S470A probably damaging Het
Morc2a C T 11: 3,685,831 T897I probably damaging Het
Nmbr A G 10: 14,760,539 probably null Het
Nosip T A 7: 45,076,574 M214K probably damaging Het
Olfr1136 A G 2: 87,693,103 F260L probably benign Het
Olfr159 G T 4: 43,770,230 Y260* probably null Het
Olfr553 A T 7: 102,614,370 N206K possibly damaging Het
Olfr569 T C 7: 102,888,078 Y25C probably benign Het
Pik3c2a A T 7: 116,417,664 V286E probably damaging Het
Ppfia4 T A 1: 134,324,573 I388F probably benign Het
Ppm1f A G 16: 16,917,787 H289R probably damaging Het
Ptprz1 T A 6: 22,959,712 D69E probably benign Het
Rad54b A T 4: 11,612,770 T801S probably damaging Het
Ramp1 A T 1: 91,196,857 N47Y probably damaging Het
Rnf32 T A 5: 29,206,260 H181Q possibly damaging Het
Rpa2 T C 4: 132,768,685 F6L probably benign Het
Ryr2 C A 13: 11,560,586 R4842L probably damaging Het
Scn11a G T 9: 119,780,865 C972* probably null Het
Setd2 C T 9: 110,550,102 T995I probably damaging Het
Slc39a7 A G 17: 34,028,815 L471P probably damaging Het
Slc6a21 C G 7: 45,282,947 S350R probably damaging Het
Slx4ip A G 2: 137,068,195 N300S probably benign Het
Spef2 G A 15: 9,679,349 P634L probably damaging Het
Stk32b G A 5: 37,466,758 A215V probably damaging Het
Svil A T 18: 5,097,545 Y1676F probably damaging Het
Tanc1 G A 2: 59,791,679 V381M probably damaging Het
Tanc2 T C 11: 105,886,386 F797L probably benign Het
Tas2r120 T G 6: 132,657,601 C215W probably benign Het
Tenm4 G A 7: 96,895,940 D2388N probably damaging Het
Thsd7b C T 1: 129,758,610 R630C probably damaging Het
Top3a A G 11: 60,759,362 I145T probably damaging Het
Vmn2r78 A G 7: 86,920,787 D171G probably benign Het
Vmn2r82 A G 10: 79,379,212 E343G probably benign Het
Wdr70 T C 15: 8,079,179 D161G probably benign Het
Other mutations in Thsd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02206:Thsd4 APN 9 60394115 missense probably benign 0.22
IGL02418:Thsd4 APN 9 60428315 missense probably damaging 0.99
IGL02491:Thsd4 APN 9 60000018 missense probably damaging 0.99
IGL02754:Thsd4 APN 9 59989097 splice site probably benign
IGL02874:Thsd4 APN 9 60252730 missense probably damaging 1.00
IGL02978:Thsd4 APN 9 60056846 splice site probably null
IGL03139:Thsd4 APN 9 59997173 missense probably benign 0.01
R0266:Thsd4 UTSW 9 59997134 missense probably benign 0.07
R0482:Thsd4 UTSW 9 60002978 missense probably damaging 1.00
R1188:Thsd4 UTSW 9 60394406 missense probably benign 0.12
R1447:Thsd4 UTSW 9 59997213 missense probably benign
R1572:Thsd4 UTSW 9 60394553 splice site probably benign
R2349:Thsd4 UTSW 9 59972515 missense probably benign 0.05
R3236:Thsd4 UTSW 9 60394387 missense probably benign
R4088:Thsd4 UTSW 9 59997222 missense probably benign 0.02
R4884:Thsd4 UTSW 9 59988037 missense probably benign 0.43
R4886:Thsd4 UTSW 9 59989030 missense probably benign 0.00
R5066:Thsd4 UTSW 9 59976332 missense probably damaging 1.00
R5223:Thsd4 UTSW 9 60057042 missense probably damaging 1.00
R5441:Thsd4 UTSW 9 59979783 missense probably damaging 1.00
R5457:Thsd4 UTSW 9 59979777 missense probably damaging 1.00
R5574:Thsd4 UTSW 9 59972400 missense probably damaging 1.00
R5581:Thsd4 UTSW 9 59972458 missense possibly damaging 0.90
R5903:Thsd4 UTSW 9 60394106 missense possibly damaging 0.47
R6220:Thsd4 UTSW 9 59982747 missense probably damaging 1.00
R6728:Thsd4 UTSW 9 59997197 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCTGAATGTCCTGGAATGC -3'
(R):5'- ACTAGATCTGCCGACCCTTC -3'

Sequencing Primer
(F):5'- AATGCCTGGCCACACTGTG -3'
(R):5'- CTCGCTCCTTCCTTCCGGATG -3'
Posted On2014-06-23