Mutagenetix > Incidental Mutations

Incidental Mutation 'R1812:Scn11a'

202485

Institutional Source

Beutler Lab

Gene Symbol

Scn11a

Ensembl Gene

ENSMUSG00000034115

Gene Name

sodium channel, voltage-gated, type XI, alpha

Synonyms

NaN, NSS2, NaT, SNS2

MMRRC Submission

039840-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.238) question?

Stock #

R1812 (G1)

Quality Score

183

Status

Not validated

Chromosome

Chromosomal Location

119753759-119825456 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to T at 119780865 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 972 (C972*)

Ref Sequence

ENSEMBL: ENSMUSP00000149420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070617] [ENSMUST00000215718]

Predicted Effect

probably null
Transcript: ENSMUST00000070617
AA Change: C972*

SMART Domains

Protein: ENSMUSP00000065466
Gene: ENSMUSG00000034115
AA Change: C972*

Domain	Start	End	E-Value	Type
low complexity region	27	43	N/A	INTRINSIC
Pfam:Ion_trans	128	409	1.1e-72	PFAM
low complexity region	475	487	N/A	INTRINSIC
Pfam:Ion_trans	574	810	4e-57	PFAM
Pfam:Na_trans_assoc	814	1030	4.1e-29	PFAM
Pfam:Ion_trans	1034	1300	5.7e-66	PFAM
Pfam:Ion_trans	1346	1595	3e-58	PFAM
low complexity region	1683	1694	N/A	INTRINSIC
low complexity region	1733	1744	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000215718
AA Change: C972*

Coding Region Coverage

1x: 97.3%
3x: 96.3%
10x: 93.2%
20x: 85.7%

Validation Efficiency

100% (1/1)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family, and is highly expressed in nociceptive neurons of dorsal root ganglia and trigeminal ganglia. It mediates brain-derived neurotrophic factor-evoked membrane depolarization and is a major effector of peripheral inflammatory pain hypersensitivity. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy type VII and familial episodic pain syndrome-3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous and heterozygous for one null allele display decreased duration of inflammation induced thermal hyperalgesia and decreased late phase pain responses to inflammatory stimuli. Mice homozygous for a second allele appear normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	G	A	9: 57,257,457	Q545*	probably null	Het
Aadacl2	T	C	3: 60,025,077	C338R	probably damaging	Het
Abcb4	G	A	5: 8,928,578		probably null	Het
Adam17	T	C	12: 21,361,767	D41G	probably damaging	Het
Angptl7	T	A	4: 148,498,083	I119F	probably damaging	Het
Arid1b	T	A	17: 5,337,029	S1586T	probably benign	Het
Arid4b	C	T	13: 14,195,429	A1170V	probably damaging	Het
Atad5	A	G	11: 80,133,047	T1659A	probably damaging	Het
Bub1b	T	G	2: 118,632,421	D754E	probably benign	Het
Cdkn1a	T	C	17: 29,098,565	V53A	probably benign	Het
Chsy1	T	G	7: 66,171,817	V600G	probably benign	Het
Cntrl	G	A	2: 35,149,469	V561M	probably damaging	Het
Col6a5	A	G	9: 105,928,054	C1218R	unknown	Het
Crhr1	T	C	11: 104,169,147	L140P	probably damaging	Het
Cyb5b	CAGAG	CAG	8: 107,170,388		probably null	Het
Cyp3a59	A	T	5: 146,102,811	Q298L	probably damaging	Het
Dctn1	A	G	6: 83,192,518	E638G	possibly damaging	Het
Ddx41	A	G	13: 55,535,954	I88T	probably benign	Het
Diaph1	G	T	18: 37,891,018	P589Q	unknown	Het
Dip2b	C	A	15: 100,198,938		probably null	Het
Dscaml1	G	A	9: 45,751,286		probably null	Het
Dync1h1	C	T	12: 110,662,900	A4246V	possibly damaging	Het
E330009J07Rik	A	G	6: 40,409,431	I288T	probably benign	Het
Epb41l1	T	C	2: 156,496,511	I158T	probably damaging	Het
Fat1	A	G	8: 45,036,803	Y3584C	probably damaging	Het
Fxyd5	T	A	7: 31,037,930		probably null	Het
Gapvd1	T	A	2: 34,725,064	K336*	probably null	Het
Gm9637	G	A	14: 19,402,395		noncoding transcript	Het
Gpr65	C	T	12: 98,275,742	T218M	probably damaging	Het
Gsdma3	T	C	11: 98,632,393	V203A	probably damaging	Het
Helb	T	A	10: 120,089,566	K969*	probably null	Het
Hipk2	G	A	6: 38,698,163	A1188V	probably benign	Het
Itpk1	T	A	12: 102,574,058	E255D	probably benign	Het
Kif21a	T	C	15: 90,971,766	D596G	possibly damaging	Het
Kif5a	A	T	10: 127,242,010	I405N	probably benign	Het
Klk11	T	A	7: 43,777,755		probably null	Het
Luzp1	T	A	4: 136,542,331	L622M	probably benign	Het
Macf1	T	A	4: 123,432,024	I5227F	probably damaging	Het
Mapk10	A	C	5: 102,913,262	S470A	probably damaging	Het
Morc2a	C	T	11: 3,685,831	T897I	probably damaging	Het
Nmbr	A	G	10: 14,760,539		probably null	Het
Nosip	T	A	7: 45,076,574	M214K	probably damaging	Het
Olfr1136	A	G	2: 87,693,103	F260L	probably benign	Het
Olfr159	G	T	4: 43,770,230	Y260*	probably null	Het
Olfr553	A	T	7: 102,614,370	N206K	possibly damaging	Het
Olfr569	T	C	7: 102,888,078	Y25C	probably benign	Het
Pik3c2a	A	T	7: 116,417,664	V286E	probably damaging	Het
Ppfia4	T	A	1: 134,324,573	I388F	probably benign	Het
Ppm1f	A	G	16: 16,917,787	H289R	probably damaging	Het
Ptprz1	T	A	6: 22,959,712	D69E	probably benign	Het
Rad54b	A	T	4: 11,612,770	T801S	probably damaging	Het
Ramp1	A	T	1: 91,196,857	N47Y	probably damaging	Het
Rnf32	T	A	5: 29,206,260	H181Q	possibly damaging	Het
Rpa2	T	C	4: 132,768,685	F6L	probably benign	Het
Ryr2	C	A	13: 11,560,586	R4842L	probably damaging	Het
Setd2	C	T	9: 110,550,102	T995I	probably damaging	Het
Slc39a7	A	G	17: 34,028,815	L471P	probably damaging	Het
Slc6a21	C	G	7: 45,282,947	S350R	probably damaging	Het
Slx4ip	A	G	2: 137,068,195	N300S	probably benign	Het
Spef2	G	A	15: 9,679,349	P634L	probably damaging	Het
Stk32b	G	A	5: 37,466,758	A215V	probably damaging	Het
Svil	A	T	18: 5,097,545	Y1676F	probably damaging	Het
Tanc1	G	A	2: 59,791,679	V381M	probably damaging	Het
Tanc2	T	C	11: 105,886,386	F797L	probably benign	Het
Tas2r120	T	G	6: 132,657,601	C215W	probably benign	Het
Tenm4	G	A	7: 96,895,940	D2388N	probably damaging	Het
Thsd4	C	T	9: 60,056,937	S64N	probably damaging	Het
Thsd7b	C	T	1: 129,758,610	R630C	probably damaging	Het
Top3a	A	G	11: 60,759,362	I145T	probably damaging	Het
Vmn2r78	A	G	7: 86,920,787	D171G	probably benign	Het
Vmn2r82	A	G	10: 79,379,212	E343G	probably benign	Het
Wdr70	T	C	15: 8,079,179	D161G	probably benign	Het

Other mutations in Scn11a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Scn11a	APN	9	119770506	missense	probably benign	0.00
IGL00272:Scn11a	APN	9	119816603	missense	probably damaging	0.98
IGL00332:Scn11a	APN	9	119769916	missense	probably damaging	1.00
IGL00533:Scn11a	APN	9	119774381	missense	probably damaging	1.00
IGL00972:Scn11a	APN	9	119793938	missense	probably benign	0.44
IGL01338:Scn11a	APN	9	119784161	splice site	probably benign
IGL01534:Scn11a	APN	9	119780822	missense	probably benign	0.27
IGL01838:Scn11a	APN	9	119758583	missense	probably damaging	1.00
IGL01991:Scn11a	APN	9	119819904	missense	probably damaging	0.97
IGL02057:Scn11a	APN	9	119765470	missense	probably damaging	1.00
IGL02290:Scn11a	APN	9	119774442	missense	probably damaging	0.97
IGL02454:Scn11a	APN	9	119758544	missense	probably benign	0.00
IGL02517:Scn11a	APN	9	119792398	missense	probably damaging	1.00
IGL02567:Scn11a	APN	9	119804489	missense	probably damaging	0.99
IGL02587:Scn11a	APN	9	119805684	missense	probably damaging	1.00
IGL03069:Scn11a	APN	9	119789963	missense	probably benign	0.16
IGL03171:Scn11a	APN	9	119819847	missense	probably benign	0.00
Kleinie	UTSW	9	119803503	missense	probably benign	0.16
H8441:Scn11a	UTSW	9	119807910	missense	probably damaging	1.00
R0304:Scn11a	UTSW	9	119819862	missense	probably benign	0.00
R0519:Scn11a	UTSW	9	119790119	missense	probably damaging	1.00
R0658:Scn11a	UTSW	9	119811160	missense	probably benign	0.41
R0828:Scn11a	UTSW	9	119755007	missense	probably benign	0.00
R0893:Scn11a	UTSW	9	119803330	splice site	probably null
R0932:Scn11a	UTSW	9	119807810	missense	probably damaging	1.00
R1061:Scn11a	UTSW	9	119795663	missense	probably damaging	0.98
R1161:Scn11a	UTSW	9	119755057	nonsense	probably null
R1162:Scn11a	UTSW	9	119805644	splice site	probably benign
R1310:Scn11a	UTSW	9	119755057	nonsense	probably null
R1589:Scn11a	UTSW	9	119769807	missense	probably damaging	1.00
R1681:Scn11a	UTSW	9	119804412	missense	possibly damaging	0.46
R1781:Scn11a	UTSW	9	119755082	missense	probably damaging	1.00
R1901:Scn11a	UTSW	9	119779036	nonsense	probably null
R1978:Scn11a	UTSW	9	119780795	nonsense	probably null
R1985:Scn11a	UTSW	9	119754678	missense	probably benign	0.19
R2022:Scn11a	UTSW	9	119811208	missense	possibly damaging	0.88
R2072:Scn11a	UTSW	9	119811208	missense	possibly damaging	0.88
R2098:Scn11a	UTSW	9	119792494	missense	possibly damaging	0.67
R2163:Scn11a	UTSW	9	119755025	missense	probably damaging	1.00
R2250:Scn11a	UTSW	9	119758602	missense	probably benign	0.01
R2373:Scn11a	UTSW	9	119813186	missense	probably benign	0.43
R2508:Scn11a	UTSW	9	119765529	missense	probably damaging	1.00
R3757:Scn11a	UTSW	9	119803503	missense	probably benign	0.16
R3767:Scn11a	UTSW	9	119784049	missense	probably damaging	1.00
R3770:Scn11a	UTSW	9	119784049	missense	probably damaging	1.00
R4089:Scn11a	UTSW	9	119795653	splice site	probably null
R4092:Scn11a	UTSW	9	119789970	missense	probably benign	0.03
R4247:Scn11a	UTSW	9	119807886	missense	probably damaging	1.00
R4279:Scn11a	UTSW	9	119754362	missense	probably benign	0.25
R4299:Scn11a	UTSW	9	119765506	missense	probably damaging	0.97
R4403:Scn11a	UTSW	9	119795667	missense	probably damaging	1.00
R4468:Scn11a	UTSW	9	119754987	missense	probably damaging	1.00
R4542:Scn11a	UTSW	9	119755134	missense	probably damaging	1.00
R4644:Scn11a	UTSW	9	119815203	splice site	probably null
R4739:Scn11a	UTSW	9	119754561	missense	probably benign	0.39
R4809:Scn11a	UTSW	9	119819870	missense	probably benign	0.00
R4954:Scn11a	UTSW	9	119758659	missense	possibly damaging	0.84
R5012:Scn11a	UTSW	9	119780878	missense	probably benign	0.31
R5044:Scn11a	UTSW	9	119819831	missense	probably damaging	0.98
R5222:Scn11a	UTSW	9	119815202	splice site	probably null
R5224:Scn11a	UTSW	9	119754792	missense	probably damaging	1.00
R5400:Scn11a	UTSW	9	119769908	missense	probably damaging	0.97
R5555:Scn11a	UTSW	9	119755238	missense	probably damaging	1.00
R5711:Scn11a	UTSW	9	119789924	missense	probably damaging	1.00
R5950:Scn11a	UTSW	9	119811124	missense	probably damaging	1.00
R5984:Scn11a	UTSW	9	119784016	missense	probably benign
R6057:Scn11a	UTSW	9	119765448	missense	probably damaging	1.00
R6104:Scn11a	UTSW	9	119795678	missense	probably damaging	1.00
R6180:Scn11a	UTSW	9	119754867	missense	probably benign	0.00
R6892:Scn11a	UTSW	9	119806969	missense	possibly damaging	0.53
R6908:Scn11a	UTSW	9	119792426	missense	probably damaging	1.00
R6949:Scn11a	UTSW	9	119765514	missense	probably benign	0.04
Z1088:Scn11a	UTSW	9	119755242	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTGTGTGGATGGATCATACC -3'
(R):5'- TGCAGCAATGTTGGCAGAG -3'

Sequencing Primer
(F):5'- CTGTGTGGATGGATCATACCTAAACC -3'
(R):5'- CAGCAATGTTGGCAGAGAACTTAAC -3'

Posted On

2014-06-23