Incidental Mutation 'R1812:Arid4b'
ID202503
Institutional Source Beutler Lab
Gene Symbol Arid4b
Ensembl Gene ENSMUSG00000039219
Gene NameAT rich interactive domain 4B (RBP1-like)
Synonyms6720480E17Rik, RBBP1L1, Rbp1l1, BRCAA1, SAP180, 6330417L24Rik
MMRRC Submission 039840-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1812 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location14063232-14199603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14195429 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 1170 (A1170V)
Ref Sequence ENSEMBL: ENSMUSP00000106165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039538] [ENSMUST00000110534] [ENSMUST00000110536]
Predicted Effect probably damaging
Transcript: ENSMUST00000039538
AA Change: A1170V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043889
Gene: ENSMUSG00000039219
AA Change: A1170V

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 3.4e-46 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
low complexity region 704 713 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 769 785 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
low complexity region 954 964 N/A INTRINSIC
low complexity region 1002 1016 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
coiled coil region 1145 1182 N/A INTRINSIC
low complexity region 1186 1204 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110534
AA Change: A1257V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106163
Gene: ENSMUSG00000039219
AA Change: A1257V

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 168 263 4.1e-39 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
TUDOR 567 632 1.91e1 SMART
CHROMO 585 640 1.29e-1 SMART
low complexity region 708 722 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
low complexity region 802 815 N/A INTRINSIC
low complexity region 856 872 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
low complexity region 1041 1051 N/A INTRINSIC
low complexity region 1089 1103 N/A INTRINSIC
low complexity region 1141 1155 N/A INTRINSIC
coiled coil region 1232 1269 N/A INTRINSIC
low complexity region 1273 1291 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110536
AA Change: A1170V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106165
Gene: ENSMUSG00000039219
AA Change: A1170V

DomainStartEndE-ValueType
TUDOR 58 114 4.13e-9 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:RBB1NT 166 264 3.4e-46 PFAM
ARID 303 394 3.81e-34 SMART
BRIGHT 307 399 4.99e-36 SMART
low complexity region 421 441 N/A INTRINSIC
low complexity region 543 562 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
low complexity region 704 713 N/A INTRINSIC
low complexity region 715 728 N/A INTRINSIC
low complexity region 769 785 N/A INTRINSIC
low complexity region 937 949 N/A INTRINSIC
low complexity region 954 964 N/A INTRINSIC
low complexity region 1002 1016 N/A INTRINSIC
low complexity region 1054 1068 N/A INTRINSIC
coiled coil region 1145 1182 N/A INTRINSIC
low complexity region 1186 1204 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148941
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149579
Predicted Effect probably benign
Transcript: ENSMUST00000151151
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with sequence similarity to retinoblastoma-binding protein-1. The encoded protein is a subunit of the histone deacetylase-dependant SIN3A transcriptional corepressor complex, which functions in diverse cellular processes including proliferation, differentiation, apoptosis, oncogenesis, and cell fate determination. The gene product is recognized by IgG antibody isolated from a breast cancer patient and appears to be a molecular marker associated with a broad range of human malignancies. Alternate transcriptional splice variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele die pre-implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,257,457 Q545* probably null Het
Aadacl2 T C 3: 60,025,077 C338R probably damaging Het
Abcb4 G A 5: 8,928,578 probably null Het
Adam17 T C 12: 21,361,767 D41G probably damaging Het
Angptl7 T A 4: 148,498,083 I119F probably damaging Het
Arid1b T A 17: 5,337,029 S1586T probably benign Het
Atad5 A G 11: 80,133,047 T1659A probably damaging Het
Bub1b T G 2: 118,632,421 D754E probably benign Het
Cdkn1a T C 17: 29,098,565 V53A probably benign Het
Chsy1 T G 7: 66,171,817 V600G probably benign Het
Cntrl G A 2: 35,149,469 V561M probably damaging Het
Col6a5 A G 9: 105,928,054 C1218R unknown Het
Crhr1 T C 11: 104,169,147 L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,170,388 probably null Het
Cyp3a59 A T 5: 146,102,811 Q298L probably damaging Het
Dctn1 A G 6: 83,192,518 E638G possibly damaging Het
Ddx41 A G 13: 55,535,954 I88T probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Dip2b C A 15: 100,198,938 probably null Het
Dscaml1 G A 9: 45,751,286 probably null Het
Dync1h1 C T 12: 110,662,900 A4246V possibly damaging Het
E330009J07Rik A G 6: 40,409,431 I288T probably benign Het
Epb41l1 T C 2: 156,496,511 I158T probably damaging Het
Fat1 A G 8: 45,036,803 Y3584C probably damaging Het
Fxyd5 T A 7: 31,037,930 probably null Het
Gapvd1 T A 2: 34,725,064 K336* probably null Het
Gm9637 G A 14: 19,402,395 noncoding transcript Het
Gpr65 C T 12: 98,275,742 T218M probably damaging Het
Gsdma3 T C 11: 98,632,393 V203A probably damaging Het
Helb T A 10: 120,089,566 K969* probably null Het
Hipk2 G A 6: 38,698,163 A1188V probably benign Het
Itpk1 T A 12: 102,574,058 E255D probably benign Het
Kif21a T C 15: 90,971,766 D596G possibly damaging Het
Kif5a A T 10: 127,242,010 I405N probably benign Het
Klk11 T A 7: 43,777,755 probably null Het
Luzp1 T A 4: 136,542,331 L622M probably benign Het
Macf1 T A 4: 123,432,024 I5227F probably damaging Het
Mapk10 A C 5: 102,913,262 S470A probably damaging Het
Morc2a C T 11: 3,685,831 T897I probably damaging Het
Nmbr A G 10: 14,760,539 probably null Het
Nosip T A 7: 45,076,574 M214K probably damaging Het
Olfr1136 A G 2: 87,693,103 F260L probably benign Het
Olfr159 G T 4: 43,770,230 Y260* probably null Het
Olfr553 A T 7: 102,614,370 N206K possibly damaging Het
Olfr569 T C 7: 102,888,078 Y25C probably benign Het
Pik3c2a A T 7: 116,417,664 V286E probably damaging Het
Ppfia4 T A 1: 134,324,573 I388F probably benign Het
Ppm1f A G 16: 16,917,787 H289R probably damaging Het
Ptprz1 T A 6: 22,959,712 D69E probably benign Het
Rad54b A T 4: 11,612,770 T801S probably damaging Het
Ramp1 A T 1: 91,196,857 N47Y probably damaging Het
Rnf32 T A 5: 29,206,260 H181Q possibly damaging Het
Rpa2 T C 4: 132,768,685 F6L probably benign Het
Ryr2 C A 13: 11,560,586 R4842L probably damaging Het
Scn11a G T 9: 119,780,865 C972* probably null Het
Setd2 C T 9: 110,550,102 T995I probably damaging Het
Slc39a7 A G 17: 34,028,815 L471P probably damaging Het
Slc6a21 C G 7: 45,282,947 S350R probably damaging Het
Slx4ip A G 2: 137,068,195 N300S probably benign Het
Spef2 G A 15: 9,679,349 P634L probably damaging Het
Stk32b G A 5: 37,466,758 A215V probably damaging Het
Svil A T 18: 5,097,545 Y1676F probably damaging Het
Tanc1 G A 2: 59,791,679 V381M probably damaging Het
Tanc2 T C 11: 105,886,386 F797L probably benign Het
Tas2r120 T G 6: 132,657,601 C215W probably benign Het
Tenm4 G A 7: 96,895,940 D2388N probably damaging Het
Thsd4 C T 9: 60,056,937 S64N probably damaging Het
Thsd7b C T 1: 129,758,610 R630C probably damaging Het
Top3a A G 11: 60,759,362 I145T probably damaging Het
Vmn2r78 A G 7: 86,920,787 D171G probably benign Het
Vmn2r82 A G 10: 79,379,212 E343G probably benign Het
Wdr70 T C 15: 8,079,179 D161G probably benign Het
Other mutations in Arid4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Arid4b APN 13 14191134 unclassified probably benign
IGL00581:Arid4b APN 13 14160195 missense probably damaging 1.00
IGL00808:Arid4b APN 13 14136261 critical splice donor site probably null
IGL01150:Arid4b APN 13 14195374 nonsense probably null
IGL01570:Arid4b APN 13 14186809 unclassified probably benign
IGL01942:Arid4b APN 13 14136164 intron probably benign
IGL02031:Arid4b APN 13 14153412 splice site probably benign
IGL02183:Arid4b APN 13 14169990 missense possibly damaging 0.68
R0096:Arid4b UTSW 13 14129194 missense probably benign 0.08
R0096:Arid4b UTSW 13 14129194 missense probably benign 0.08
R0514:Arid4b UTSW 13 14184317 missense probably damaging 1.00
R0694:Arid4b UTSW 13 14187834 missense probably damaging 0.96
R0746:Arid4b UTSW 13 14143038 missense probably benign 0.01
R1624:Arid4b UTSW 13 14184394 missense probably damaging 0.99
R1625:Arid4b UTSW 13 14187114 missense probably damaging 0.99
R1891:Arid4b UTSW 13 14136236 missense possibly damaging 0.94
R1990:Arid4b UTSW 13 14132436 missense probably damaging 0.99
R2051:Arid4b UTSW 13 14187645 missense probably damaging 0.98
R2060:Arid4b UTSW 13 14195452 missense probably damaging 1.00
R2344:Arid4b UTSW 13 14153490 missense probably benign 0.26
R3605:Arid4b UTSW 13 14120241 missense probably damaging 1.00
R3606:Arid4b UTSW 13 14120241 missense probably damaging 1.00
R3844:Arid4b UTSW 13 14187060 missense probably damaging 0.99
R3909:Arid4b UTSW 13 14132484 missense probably damaging 1.00
R3938:Arid4b UTSW 13 14186928 missense probably benign 0.34
R4394:Arid4b UTSW 13 14154972 splice site probably null
R4466:Arid4b UTSW 13 14132510 missense probably damaging 1.00
R4530:Arid4b UTSW 13 14126455 missense probably damaging 0.98
R4537:Arid4b UTSW 13 14120161 nonsense probably null
R4829:Arid4b UTSW 13 14184438 missense probably benign 0.23
R4930:Arid4b UTSW 13 14187477 missense probably damaging 0.99
R4972:Arid4b UTSW 13 14160272 missense probably benign 0.07
R5119:Arid4b UTSW 13 14164281 missense probably benign 0.15
R5236:Arid4b UTSW 13 14126449 critical splice acceptor site probably null
R5304:Arid4b UTSW 13 14186929 missense probably benign 0.34
R5439:Arid4b UTSW 13 14187696 missense probably damaging 0.99
R5734:Arid4b UTSW 13 14160271 missense probably benign 0.09
R5950:Arid4b UTSW 13 14191264 splice site probably benign
R5951:Arid4b UTSW 13 14143063 missense possibly damaging 0.80
R6645:Arid4b UTSW 13 14120152 missense probably damaging 1.00
R6765:Arid4b UTSW 13 14187315 missense possibly damaging 0.84
R6804:Arid4b UTSW 13 14129207 missense probably benign 0.44
R7342:Arid4b UTSW 13 14136219 missense probably benign 0.03
R7354:Arid4b UTSW 13 14164870 missense probably benign 0.19
R7426:Arid4b UTSW 13 14181306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGCACCAACACACATGG -3'
(R):5'- GCACTGTGATGTCATTAACAGATG -3'

Sequencing Primer
(F):5'- GACCTTACTCTAAGACTACATTGGC -3'
(R):5'- TGTCATTAACAGATGAAGCTGACAGC -3'
Posted On2014-06-23