Incidental Mutation 'R1812:Ddx41'
ID202504
Institutional Source Beutler Lab
Gene Symbol Ddx41
Ensembl Gene ENSMUSG00000021494
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 41
Synonyms2900024F02Rik
MMRRC Submission 039840-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R1812 (G1)
Quality Score138
Status Not validated
Chromosome13
Chromosomal Location55530410-55536658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55535954 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 88 (I88T)
Ref Sequence ENSEMBL: ENSMUSP00000153348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021956] [ENSMUST00000021957] [ENSMUST00000224765]
Predicted Effect probably benign
Transcript: ENSMUST00000021956
AA Change: I77T

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000021956
Gene: ENSMUSG00000021494
AA Change: I77T

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 39 56 N/A INTRINSIC
low complexity region 95 115 N/A INTRINSIC
DEXDc 200 411 8.56e-53 SMART
HELICc 446 527 5.99e-34 SMART
ZnF_C2HC 581 597 1.98e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021957
SMART Domains Protein: ENSMUSP00000021957
Gene: ENSMUSG00000021495

DomainStartEndE-ValueType
low complexity region 55 71 N/A INTRINSIC
low complexity region 133 144 N/A INTRINSIC
low complexity region 161 174 N/A INTRINSIC
low complexity region 198 242 N/A INTRINSIC
low complexity region 260 286 N/A INTRINSIC
coiled coil region 371 404 N/A INTRINSIC
low complexity region 566 573 N/A INTRINSIC
low complexity region 622 635 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
Pfam:FAM193_C 722 776 9.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224486
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224686
Predicted Effect probably benign
Transcript: ENSMUST00000224765
AA Change: I88T

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225703
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225783
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD box protein family and interacts with several spliceosomal proteins. In addition, the encoded protein may recognize the bacterial second messengers cyclic di-GMP and cyclic di-AMP, resulting in the induction of genes involved in the innate immune response. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,257,457 Q545* probably null Het
Aadacl2 T C 3: 60,025,077 C338R probably damaging Het
Abcb4 G A 5: 8,928,578 probably null Het
Adam17 T C 12: 21,361,767 D41G probably damaging Het
Angptl7 T A 4: 148,498,083 I119F probably damaging Het
Arid1b T A 17: 5,337,029 S1586T probably benign Het
Arid4b C T 13: 14,195,429 A1170V probably damaging Het
Atad5 A G 11: 80,133,047 T1659A probably damaging Het
Bub1b T G 2: 118,632,421 D754E probably benign Het
Cdkn1a T C 17: 29,098,565 V53A probably benign Het
Chsy1 T G 7: 66,171,817 V600G probably benign Het
Cntrl G A 2: 35,149,469 V561M probably damaging Het
Col6a5 A G 9: 105,928,054 C1218R unknown Het
Crhr1 T C 11: 104,169,147 L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,170,388 probably null Het
Cyp3a59 A T 5: 146,102,811 Q298L probably damaging Het
Dctn1 A G 6: 83,192,518 E638G possibly damaging Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Dip2b C A 15: 100,198,938 probably null Het
Dscaml1 G A 9: 45,751,286 probably null Het
Dync1h1 C T 12: 110,662,900 A4246V possibly damaging Het
E330009J07Rik A G 6: 40,409,431 I288T probably benign Het
Epb41l1 T C 2: 156,496,511 I158T probably damaging Het
Fat1 A G 8: 45,036,803 Y3584C probably damaging Het
Fxyd5 T A 7: 31,037,930 probably null Het
Gapvd1 T A 2: 34,725,064 K336* probably null Het
Gm9637 G A 14: 19,402,395 noncoding transcript Het
Gpr65 C T 12: 98,275,742 T218M probably damaging Het
Gsdma3 T C 11: 98,632,393 V203A probably damaging Het
Helb T A 10: 120,089,566 K969* probably null Het
Hipk2 G A 6: 38,698,163 A1188V probably benign Het
Itpk1 T A 12: 102,574,058 E255D probably benign Het
Kif21a T C 15: 90,971,766 D596G possibly damaging Het
Kif5a A T 10: 127,242,010 I405N probably benign Het
Klk11 T A 7: 43,777,755 probably null Het
Luzp1 T A 4: 136,542,331 L622M probably benign Het
Macf1 T A 4: 123,432,024 I5227F probably damaging Het
Mapk10 A C 5: 102,913,262 S470A probably damaging Het
Morc2a C T 11: 3,685,831 T897I probably damaging Het
Nmbr A G 10: 14,760,539 probably null Het
Nosip T A 7: 45,076,574 M214K probably damaging Het
Olfr1136 A G 2: 87,693,103 F260L probably benign Het
Olfr159 G T 4: 43,770,230 Y260* probably null Het
Olfr553 A T 7: 102,614,370 N206K possibly damaging Het
Olfr569 T C 7: 102,888,078 Y25C probably benign Het
Pik3c2a A T 7: 116,417,664 V286E probably damaging Het
Ppfia4 T A 1: 134,324,573 I388F probably benign Het
Ppm1f A G 16: 16,917,787 H289R probably damaging Het
Ptprz1 T A 6: 22,959,712 D69E probably benign Het
Rad54b A T 4: 11,612,770 T801S probably damaging Het
Ramp1 A T 1: 91,196,857 N47Y probably damaging Het
Rnf32 T A 5: 29,206,260 H181Q possibly damaging Het
Rpa2 T C 4: 132,768,685 F6L probably benign Het
Ryr2 C A 13: 11,560,586 R4842L probably damaging Het
Scn11a G T 9: 119,780,865 C972* probably null Het
Setd2 C T 9: 110,550,102 T995I probably damaging Het
Slc39a7 A G 17: 34,028,815 L471P probably damaging Het
Slc6a21 C G 7: 45,282,947 S350R probably damaging Het
Slx4ip A G 2: 137,068,195 N300S probably benign Het
Spef2 G A 15: 9,679,349 P634L probably damaging Het
Stk32b G A 5: 37,466,758 A215V probably damaging Het
Svil A T 18: 5,097,545 Y1676F probably damaging Het
Tanc1 G A 2: 59,791,679 V381M probably damaging Het
Tanc2 T C 11: 105,886,386 F797L probably benign Het
Tas2r120 T G 6: 132,657,601 C215W probably benign Het
Tenm4 G A 7: 96,895,940 D2388N probably damaging Het
Thsd4 C T 9: 60,056,937 S64N probably damaging Het
Thsd7b C T 1: 129,758,610 R630C probably damaging Het
Top3a A G 11: 60,759,362 I145T probably damaging Het
Vmn2r78 A G 7: 86,920,787 D171G probably benign Het
Vmn2r82 A G 10: 79,379,212 E343G probably benign Het
Wdr70 T C 15: 8,079,179 D161G probably benign Het
Other mutations in Ddx41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Ddx41 APN 13 55531399 missense probably damaging 1.00
IGL00516:Ddx41 APN 13 55532467 missense probably damaging 0.96
IGL02383:Ddx41 APN 13 55532357 missense probably benign 0.04
R0081:Ddx41 UTSW 13 55535380 missense possibly damaging 0.58
R0097:Ddx41 UTSW 13 55535878 splice site probably benign
R0412:Ddx41 UTSW 13 55530608 missense probably damaging 0.99
R0597:Ddx41 UTSW 13 55533006 missense probably damaging 1.00
R0699:Ddx41 UTSW 13 55531299 splice site probably benign
R1330:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R2011:Ddx41 UTSW 13 55534093 splice site probably null
R2224:Ddx41 UTSW 13 55531401 missense probably damaging 1.00
R2310:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R2311:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R2355:Ddx41 UTSW 13 55534300 missense probably benign 0.03
R2983:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3032:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3764:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3773:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3916:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R3926:Ddx41 UTSW 13 55531270 missense probably damaging 1.00
R4153:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4154:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4372:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4470:Ddx41 UTSW 13 55534480 missense possibly damaging 0.87
R4519:Ddx41 UTSW 13 55533144 missense probably damaging 1.00
R4569:Ddx41 UTSW 13 55536021 missense possibly damaging 0.88
R4823:Ddx41 UTSW 13 55532055 missense probably benign 0.02
R4837:Ddx41 UTSW 13 55531648 missense possibly damaging 0.95
R5443:Ddx41 UTSW 13 55535291 missense probably benign 0.00
R5642:Ddx41 UTSW 13 55535895 missense possibly damaging 0.86
R5926:Ddx41 UTSW 13 55534299 missense probably damaging 0.99
R5949:Ddx41 UTSW 13 55532061 missense probably damaging 1.00
R6035:Ddx41 UTSW 13 55533968 missense probably benign 0.00
R6035:Ddx41 UTSW 13 55533968 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATGGTACCTCGGCCTTCAG -3'
(R):5'- AACCTGAGTTCCGGACAGAC -3'

Sequencing Primer
(F):5'- CAGTTGCTTTTCCTTGGCGGAC -3'
(R):5'- GCCTCAGTGCACACGATC -3'
Posted On2014-06-23