Incidental Mutation 'R1812:Ppm1f'
ID202512
Institutional Source Beutler Lab
Gene Symbol Ppm1f
Ensembl Gene ENSMUSG00000026181
Gene Nameprotein phosphatase 1F (PP2C domain containing)
Synonyms4933427B07Rik, 1110021B16Rik
MMRRC Submission 039840-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1812 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location16896469-16927364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 16917787 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 289 (H289R)
Ref Sequence ENSEMBL: ENSMUSP00000027373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027373] [ENSMUST00000232247]
Predicted Effect probably damaging
Transcript: ENSMUST00000027373
AA Change: H289R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027373
Gene: ENSMUSG00000026181
AA Change: H289R

DomainStartEndE-ValueType
Blast:PP2Cc 25 97 1e-16 BLAST
low complexity region 99 110 N/A INTRINSIC
PP2Cc 141 408 3.14e-79 SMART
PP2C_SIG 168 410 5.13e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145978
Predicted Effect probably benign
Transcript: ENSMUST00000232247
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PP2C family of Ser/Thr protein phosphatases. PP2C family members are known to be negative regulators of cell stress response pathways. This phosphatase can interact with Rho guanine nucleotide exchange factors (PIX), and thus block the effects of p21-activated kinase 1 (PAK), a protein kinase mediating biological effects downstream of Rho GTPases. Calcium/calmodulin-dependent protein kinase II gamma (CAMK2G/CAMK-II) is found to be one of the substrates of this phosphatase. The overexpression of this phosphatase or CAMK2G has been shown to mediate caspase-dependent apoptosis. An alternatively spliced transcript variant has been identified, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation are not detected at weaning. Mice heterozygous for a targeted mutation display hyperactivity and an increase in pain threshold. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,257,457 Q545* probably null Het
Aadacl2 T C 3: 60,025,077 C338R probably damaging Het
Abcb4 G A 5: 8,928,578 probably null Het
Adam17 T C 12: 21,361,767 D41G probably damaging Het
Angptl7 T A 4: 148,498,083 I119F probably damaging Het
Arid1b T A 17: 5,337,029 S1586T probably benign Het
Arid4b C T 13: 14,195,429 A1170V probably damaging Het
Atad5 A G 11: 80,133,047 T1659A probably damaging Het
Bub1b T G 2: 118,632,421 D754E probably benign Het
Cdkn1a T C 17: 29,098,565 V53A probably benign Het
Chsy1 T G 7: 66,171,817 V600G probably benign Het
Cntrl G A 2: 35,149,469 V561M probably damaging Het
Col6a5 A G 9: 105,928,054 C1218R unknown Het
Crhr1 T C 11: 104,169,147 L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,170,388 probably null Het
Cyp3a59 A T 5: 146,102,811 Q298L probably damaging Het
Dctn1 A G 6: 83,192,518 E638G possibly damaging Het
Ddx41 A G 13: 55,535,954 I88T probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Dip2b C A 15: 100,198,938 probably null Het
Dscaml1 G A 9: 45,751,286 probably null Het
Dync1h1 C T 12: 110,662,900 A4246V possibly damaging Het
E330009J07Rik A G 6: 40,409,431 I288T probably benign Het
Epb41l1 T C 2: 156,496,511 I158T probably damaging Het
Fat1 A G 8: 45,036,803 Y3584C probably damaging Het
Fxyd5 T A 7: 31,037,930 probably null Het
Gapvd1 T A 2: 34,725,064 K336* probably null Het
Gm9637 G A 14: 19,402,395 noncoding transcript Het
Gpr65 C T 12: 98,275,742 T218M probably damaging Het
Gsdma3 T C 11: 98,632,393 V203A probably damaging Het
Helb T A 10: 120,089,566 K969* probably null Het
Hipk2 G A 6: 38,698,163 A1188V probably benign Het
Itpk1 T A 12: 102,574,058 E255D probably benign Het
Kif21a T C 15: 90,971,766 D596G possibly damaging Het
Kif5a A T 10: 127,242,010 I405N probably benign Het
Klk11 T A 7: 43,777,755 probably null Het
Luzp1 T A 4: 136,542,331 L622M probably benign Het
Macf1 T A 4: 123,432,024 I5227F probably damaging Het
Mapk10 A C 5: 102,913,262 S470A probably damaging Het
Morc2a C T 11: 3,685,831 T897I probably damaging Het
Nmbr A G 10: 14,760,539 probably null Het
Nosip T A 7: 45,076,574 M214K probably damaging Het
Olfr1136 A G 2: 87,693,103 F260L probably benign Het
Olfr159 G T 4: 43,770,230 Y260* probably null Het
Olfr553 A T 7: 102,614,370 N206K possibly damaging Het
Olfr569 T C 7: 102,888,078 Y25C probably benign Het
Pik3c2a A T 7: 116,417,664 V286E probably damaging Het
Ppfia4 T A 1: 134,324,573 I388F probably benign Het
Ptprz1 T A 6: 22,959,712 D69E probably benign Het
Rad54b A T 4: 11,612,770 T801S probably damaging Het
Ramp1 A T 1: 91,196,857 N47Y probably damaging Het
Rnf32 T A 5: 29,206,260 H181Q possibly damaging Het
Rpa2 T C 4: 132,768,685 F6L probably benign Het
Ryr2 C A 13: 11,560,586 R4842L probably damaging Het
Scn11a G T 9: 119,780,865 C972* probably null Het
Setd2 C T 9: 110,550,102 T995I probably damaging Het
Slc39a7 A G 17: 34,028,815 L471P probably damaging Het
Slc6a21 C G 7: 45,282,947 S350R probably damaging Het
Slx4ip A G 2: 137,068,195 N300S probably benign Het
Spef2 G A 15: 9,679,349 P634L probably damaging Het
Stk32b G A 5: 37,466,758 A215V probably damaging Het
Svil A T 18: 5,097,545 Y1676F probably damaging Het
Tanc1 G A 2: 59,791,679 V381M probably damaging Het
Tanc2 T C 11: 105,886,386 F797L probably benign Het
Tas2r120 T G 6: 132,657,601 C215W probably benign Het
Tenm4 G A 7: 96,895,940 D2388N probably damaging Het
Thsd4 C T 9: 60,056,937 S64N probably damaging Het
Thsd7b C T 1: 129,758,610 R630C probably damaging Het
Top3a A G 11: 60,759,362 I145T probably damaging Het
Vmn2r78 A G 7: 86,920,787 D171G probably benign Het
Vmn2r82 A G 10: 79,379,212 E343G probably benign Het
Wdr70 T C 15: 8,079,179 D161G probably benign Het
Other mutations in Ppm1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Ppm1f APN 16 16923913 missense probably benign 0.03
IGL00495:Ppm1f APN 16 16910971 missense possibly damaging 0.87
IGL01024:Ppm1f APN 16 16923769 missense probably benign 0.05
IGL02076:Ppm1f APN 16 16914171 missense possibly damaging 0.93
IGL02332:Ppm1f APN 16 16914087 missense possibly damaging 0.72
IGL02422:Ppm1f APN 16 16917716 missense probably damaging 0.99
IGL02936:Ppm1f APN 16 16915236 missense probably damaging 1.00
IGL03118:Ppm1f APN 16 16914078 missense probably null 0.03
R0348:Ppm1f UTSW 16 16903390 start codon destroyed probably null 0.71
R0621:Ppm1f UTSW 16 16915308 missense probably benign 0.00
R0970:Ppm1f UTSW 16 16903593 critical splice donor site probably null
R1785:Ppm1f UTSW 16 16910970 missense probably benign
R1988:Ppm1f UTSW 16 16923666 missense probably damaging 0.98
R2080:Ppm1f UTSW 16 16923880 missense possibly damaging 0.50
R3687:Ppm1f UTSW 16 16923883 missense probably damaging 0.96
R5456:Ppm1f UTSW 16 16923746 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATAAGTAGGGCTGTGGGTTCC -3'
(R):5'- TCTGGGCTCTCACTGTGATC -3'

Sequencing Primer
(F):5'- GTGTAGGCTCGTTTTCCTCCTCAG -3'
(R):5'- AGAACTCTCTGGAGGGCTCATG -3'
Posted On2014-06-23