Incidental Mutation 'R1812:Cdkn1a'
ID202515
Institutional Source Beutler Lab
Gene Symbol Cdkn1a
Ensembl Gene ENSMUSG00000023067
Gene Namecyclin-dependent kinase inhibitor 1A (P21)
SynonymsSDI1, P21, Waf1, p21Cip1, CIP1, CAP20, mda6, p21, Cdkn1, p21WAF, CDKI
MMRRC Submission 039840-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1812 (G1)
Quality Score219
Status Not validated
Chromosome17
Chromosomal Location29090979-29100722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29098565 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 53 (V53A)
Ref Sequence ENSEMBL: ENSMUSP00000112411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023829] [ENSMUST00000119901] [ENSMUST00000122348]
Predicted Effect probably benign
Transcript: ENSMUST00000023829
AA Change: V53A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023829
Gene: ENSMUSG00000023067
AA Change: V53A

DomainStartEndE-ValueType
Pfam:CDI 19 67 8.1e-23 PFAM
PDB:2ZVW|P 134 154 8e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000119901
AA Change: V53A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113150
Gene: ENSMUSG00000023067
AA Change: V53A

DomainStartEndE-ValueType
Pfam:CDI 18 68 6.9e-24 PFAM
PDB:2ZVW|P 134 154 8e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000122348
AA Change: V53A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112411
Gene: ENSMUSG00000023067
AA Change: V53A

DomainStartEndE-ValueType
Pfam:CDI 18 68 6.9e-24 PFAM
PDB:2ZVW|P 134 154 8e-6 PDB
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: This gene encodes a potent cyclin-dependent kinase inhibitor. The encoded protein binds to and inhibits the activity of cyclin-cyclin-dependent kinase2 or cyclin-dependent kinase4 complexes, and thus functions as a regulator of cell cycle progression at the G1 pahse. The expression of this gene is tightly controlled by the tumor suppressor protein p53, through which this protein mediates the p53-dependent cell cycle G1 phase arrest in response to a variety of stress stimuli. This protein can interact with proliferating cell nuclear antigen, a DNA polymerase accessory factor, and plays a regulatory role in S phase DNA replication and DNA damage repair. This protein was reported to be specifically cleaved by CASP3-like caspases, which thus leads to a dramatic activation of cyclin-dependent kinase2, and may be instrumental in the execution of apoptosis following caspase activation. Mice that lack this gene have the ability to regenerate damaged or missing tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for knock-out alleles exhibit increased spontaneous tumorigenesis, altered resistance to induced tumors, abnormal immune system morphology and physiology, delayed cellular senescence, abnormal response to xenobiotics and injury, and autoimmunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,257,457 Q545* probably null Het
Aadacl2 T C 3: 60,025,077 C338R probably damaging Het
Abcb4 G A 5: 8,928,578 probably null Het
Adam17 T C 12: 21,361,767 D41G probably damaging Het
Angptl7 T A 4: 148,498,083 I119F probably damaging Het
Arid1b T A 17: 5,337,029 S1586T probably benign Het
Arid4b C T 13: 14,195,429 A1170V probably damaging Het
Atad5 A G 11: 80,133,047 T1659A probably damaging Het
Bub1b T G 2: 118,632,421 D754E probably benign Het
Chsy1 T G 7: 66,171,817 V600G probably benign Het
Cntrl G A 2: 35,149,469 V561M probably damaging Het
Col6a5 A G 9: 105,928,054 C1218R unknown Het
Crhr1 T C 11: 104,169,147 L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,170,388 probably null Het
Cyp3a59 A T 5: 146,102,811 Q298L probably damaging Het
Dctn1 A G 6: 83,192,518 E638G possibly damaging Het
Ddx41 A G 13: 55,535,954 I88T probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Dip2b C A 15: 100,198,938 probably null Het
Dscaml1 G A 9: 45,751,286 probably null Het
Dync1h1 C T 12: 110,662,900 A4246V possibly damaging Het
E330009J07Rik A G 6: 40,409,431 I288T probably benign Het
Epb41l1 T C 2: 156,496,511 I158T probably damaging Het
Fat1 A G 8: 45,036,803 Y3584C probably damaging Het
Fxyd5 T A 7: 31,037,930 probably null Het
Gapvd1 T A 2: 34,725,064 K336* probably null Het
Gm9637 G A 14: 19,402,395 noncoding transcript Het
Gpr65 C T 12: 98,275,742 T218M probably damaging Het
Gsdma3 T C 11: 98,632,393 V203A probably damaging Het
Helb T A 10: 120,089,566 K969* probably null Het
Hipk2 G A 6: 38,698,163 A1188V probably benign Het
Itpk1 T A 12: 102,574,058 E255D probably benign Het
Kif21a T C 15: 90,971,766 D596G possibly damaging Het
Kif5a A T 10: 127,242,010 I405N probably benign Het
Klk11 T A 7: 43,777,755 probably null Het
Luzp1 T A 4: 136,542,331 L622M probably benign Het
Macf1 T A 4: 123,432,024 I5227F probably damaging Het
Mapk10 A C 5: 102,913,262 S470A probably damaging Het
Morc2a C T 11: 3,685,831 T897I probably damaging Het
Nmbr A G 10: 14,760,539 probably null Het
Nosip T A 7: 45,076,574 M214K probably damaging Het
Olfr1136 A G 2: 87,693,103 F260L probably benign Het
Olfr159 G T 4: 43,770,230 Y260* probably null Het
Olfr553 A T 7: 102,614,370 N206K possibly damaging Het
Olfr569 T C 7: 102,888,078 Y25C probably benign Het
Pik3c2a A T 7: 116,417,664 V286E probably damaging Het
Ppfia4 T A 1: 134,324,573 I388F probably benign Het
Ppm1f A G 16: 16,917,787 H289R probably damaging Het
Ptprz1 T A 6: 22,959,712 D69E probably benign Het
Rad54b A T 4: 11,612,770 T801S probably damaging Het
Ramp1 A T 1: 91,196,857 N47Y probably damaging Het
Rnf32 T A 5: 29,206,260 H181Q possibly damaging Het
Rpa2 T C 4: 132,768,685 F6L probably benign Het
Ryr2 C A 13: 11,560,586 R4842L probably damaging Het
Scn11a G T 9: 119,780,865 C972* probably null Het
Setd2 C T 9: 110,550,102 T995I probably damaging Het
Slc39a7 A G 17: 34,028,815 L471P probably damaging Het
Slc6a21 C G 7: 45,282,947 S350R probably damaging Het
Slx4ip A G 2: 137,068,195 N300S probably benign Het
Spef2 G A 15: 9,679,349 P634L probably damaging Het
Stk32b G A 5: 37,466,758 A215V probably damaging Het
Svil A T 18: 5,097,545 Y1676F probably damaging Het
Tanc1 G A 2: 59,791,679 V381M probably damaging Het
Tanc2 T C 11: 105,886,386 F797L probably benign Het
Tas2r120 T G 6: 132,657,601 C215W probably benign Het
Tenm4 G A 7: 96,895,940 D2388N probably damaging Het
Thsd4 C T 9: 60,056,937 S64N probably damaging Het
Thsd7b C T 1: 129,758,610 R630C probably damaging Het
Top3a A G 11: 60,759,362 I145T probably damaging Het
Vmn2r78 A G 7: 86,920,787 D171G probably benign Het
Vmn2r82 A G 10: 79,379,212 E343G probably benign Het
Wdr70 T C 15: 8,079,179 D161G probably benign Het
Other mutations in Cdkn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Cdkn1a APN 17 29098520 missense possibly damaging 0.83
IGL00495:Cdkn1a APN 17 29098520 missense possibly damaging 0.83
IGL00516:Cdkn1a APN 17 29098520 missense possibly damaging 0.83
IGL02409:Cdkn1a APN 17 29098454 missense probably benign
R6076:Cdkn1a UTSW 17 29099358 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGTTTCCATAGTGACCCGG -3'
(R):5'- AATCTTCAGGCCGCTCAGAC -3'

Sequencing Primer
(F):5'- ATAGTGACCCGGGTCCTTC -3'
(R):5'- CCAGAGTGCAAGACAGCGAC -3'
Posted On2014-06-23