Incidental Mutation 'R1812:Slc39a7'
ID202516
Institutional Source Beutler Lab
Gene Symbol Slc39a7
Ensembl Gene ENSMUSG00000024327
Gene Namesolute carrier family 39 (zinc transporter), member 7
SynonymsKE4, Ke-4, Ring5, Zip7, H-2Ke4, H2-Ke4
MMRRC Submission 039840-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.419) question?
Stock #R1812 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34028267-34031690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34028815 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 471 (L471P)
Ref Sequence ENSEMBL: ENSMUSP00000130102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025183] [ENSMUST00000025186] [ENSMUST00000044858] [ENSMUST00000045467] [ENSMUST00000114303] [ENSMUST00000116612] [ENSMUST00000169397] [ENSMUST00000171872] [ENSMUST00000173354] [ENSMUST00000173554]
Predicted Effect probably benign
Transcript: ENSMUST00000025183
SMART Domains Protein: ENSMUSP00000025183
Gene: ENSMUSG00000024325

DomainStartEndE-ValueType
RING 48 87 7.92e-8 SMART
low complexity region 171 229 N/A INTRINSIC
low complexity region 236 261 N/A INTRINSIC
Pfam:RAWUL 272 400 4.8e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000025186
AA Change: L471P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025186
Gene: ENSMUSG00000024327
AA Change: L471P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 2.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044858
SMART Domains Protein: ENSMUSP00000036585
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
low complexity region 66 85 N/A INTRINSIC
low complexity region 94 121 N/A INTRINSIC
low complexity region 124 147 N/A INTRINSIC
low complexity region 179 186 N/A INTRINSIC
ZnF_C4 189 260 3.98e-39 SMART
low complexity region 269 282 N/A INTRINSIC
low complexity region 305 316 N/A INTRINSIC
HOLI 328 491 1.91e-50 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045467
SMART Domains Protein: ENSMUSP00000038069
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 201 1.5e-16 PFAM
Pfam:adh_short 10 213 4.5e-52 PFAM
Pfam:adh_short_C2 16 258 8.6e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083621
Predicted Effect probably benign
Transcript: ENSMUST00000114303
SMART Domains Protein: ENSMUSP00000133546
Gene: ENSMUSG00000073422

DomainStartEndE-ValueType
Pfam:KR 10 202 5.5e-16 PFAM
Pfam:adh_short 22 193 2.7e-30 PFAM
Pfam:adh_short_C2 23 234 1.4e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116612
SMART Domains Protein: ENSMUSP00000112311
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.3e-10 PFAM
ZnF_C4 79 150 3.98e-39 SMART
low complexity region 159 172 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
HOLI 218 377 1.35e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168978
Predicted Effect probably damaging
Transcript: ENSMUST00000169397
AA Change: L471P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130102
Gene: ENSMUSG00000024327
AA Change: L471P

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 473 1.9e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170644
Predicted Effect probably benign
Transcript: ENSMUST00000171872
SMART Domains Protein: ENSMUSP00000133146
Gene: ENSMUSG00000024327

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 39 77 N/A INTRINSIC
low complexity region 80 123 N/A INTRINSIC
Pfam:Zip 140 246 4.7e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172739
Predicted Effect probably benign
Transcript: ENSMUST00000173354
SMART Domains Protein: ENSMUSP00000133661
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.3e-10 PFAM
ZnF_C4 79 150 3.98e-39 SMART
low complexity region 159 172 N/A INTRINSIC
low complexity region 195 206 N/A INTRINSIC
HOLI 218 381 1.91e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173425
Predicted Effect probably benign
Transcript: ENSMUST00000173554
SMART Domains Protein: ENSMUSP00000134299
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
Pfam:Nuc_recep-AF1 2 76 4.9e-11 PFAM
ZnF_C4 79 150 3.98e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173616
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174054
Predicted Effect probably benign
Transcript: ENSMUST00000174299
SMART Domains Protein: ENSMUSP00000133775
Gene: ENSMUSG00000039656

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 25 52 N/A INTRINSIC
low complexity region 55 78 N/A INTRINSIC
low complexity region 110 117 N/A INTRINSIC
ZnF_C4 120 191 3.98e-39 SMART
low complexity region 200 213 N/A INTRINSIC
low complexity region 236 247 N/A INTRINSIC
HOLI 259 418 1.35e-50 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174851
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199860
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene transports zinc from the Golgi and endoplasmic reticulum to the cytoplasm. This transport may be important for activation of tyrosine kinases, some of which could be involved in cancer progression. Therefore, modulation of the encoded protein could be useful as a therapeutic agent against cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a conditional allele activated in intestinal epithelial cells exhibit premature death, loss of epithelial integrity, reduced enterocyte proliferation and increased enterocyte apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,257,457 Q545* probably null Het
Aadacl2 T C 3: 60,025,077 C338R probably damaging Het
Abcb4 G A 5: 8,928,578 probably null Het
Adam17 T C 12: 21,361,767 D41G probably damaging Het
Angptl7 T A 4: 148,498,083 I119F probably damaging Het
Arid1b T A 17: 5,337,029 S1586T probably benign Het
Arid4b C T 13: 14,195,429 A1170V probably damaging Het
Atad5 A G 11: 80,133,047 T1659A probably damaging Het
Bub1b T G 2: 118,632,421 D754E probably benign Het
Cdkn1a T C 17: 29,098,565 V53A probably benign Het
Chsy1 T G 7: 66,171,817 V600G probably benign Het
Cntrl G A 2: 35,149,469 V561M probably damaging Het
Col6a5 A G 9: 105,928,054 C1218R unknown Het
Crhr1 T C 11: 104,169,147 L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,170,388 probably null Het
Cyp3a59 A T 5: 146,102,811 Q298L probably damaging Het
Dctn1 A G 6: 83,192,518 E638G possibly damaging Het
Ddx41 A G 13: 55,535,954 I88T probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Dip2b C A 15: 100,198,938 probably null Het
Dscaml1 G A 9: 45,751,286 probably null Het
Dync1h1 C T 12: 110,662,900 A4246V possibly damaging Het
E330009J07Rik A G 6: 40,409,431 I288T probably benign Het
Epb41l1 T C 2: 156,496,511 I158T probably damaging Het
Fat1 A G 8: 45,036,803 Y3584C probably damaging Het
Fxyd5 T A 7: 31,037,930 probably null Het
Gapvd1 T A 2: 34,725,064 K336* probably null Het
Gm9637 G A 14: 19,402,395 noncoding transcript Het
Gpr65 C T 12: 98,275,742 T218M probably damaging Het
Gsdma3 T C 11: 98,632,393 V203A probably damaging Het
Helb T A 10: 120,089,566 K969* probably null Het
Hipk2 G A 6: 38,698,163 A1188V probably benign Het
Itpk1 T A 12: 102,574,058 E255D probably benign Het
Kif21a T C 15: 90,971,766 D596G possibly damaging Het
Kif5a A T 10: 127,242,010 I405N probably benign Het
Klk11 T A 7: 43,777,755 probably null Het
Luzp1 T A 4: 136,542,331 L622M probably benign Het
Macf1 T A 4: 123,432,024 I5227F probably damaging Het
Mapk10 A C 5: 102,913,262 S470A probably damaging Het
Morc2a C T 11: 3,685,831 T897I probably damaging Het
Nmbr A G 10: 14,760,539 probably null Het
Nosip T A 7: 45,076,574 M214K probably damaging Het
Olfr1136 A G 2: 87,693,103 F260L probably benign Het
Olfr159 G T 4: 43,770,230 Y260* probably null Het
Olfr553 A T 7: 102,614,370 N206K possibly damaging Het
Olfr569 T C 7: 102,888,078 Y25C probably benign Het
Pik3c2a A T 7: 116,417,664 V286E probably damaging Het
Ppfia4 T A 1: 134,324,573 I388F probably benign Het
Ppm1f A G 16: 16,917,787 H289R probably damaging Het
Ptprz1 T A 6: 22,959,712 D69E probably benign Het
Rad54b A T 4: 11,612,770 T801S probably damaging Het
Ramp1 A T 1: 91,196,857 N47Y probably damaging Het
Rnf32 T A 5: 29,206,260 H181Q possibly damaging Het
Rpa2 T C 4: 132,768,685 F6L probably benign Het
Ryr2 C A 13: 11,560,586 R4842L probably damaging Het
Scn11a G T 9: 119,780,865 C972* probably null Het
Setd2 C T 9: 110,550,102 T995I probably damaging Het
Slc6a21 C G 7: 45,282,947 S350R probably damaging Het
Slx4ip A G 2: 137,068,195 N300S probably benign Het
Spef2 G A 15: 9,679,349 P634L probably damaging Het
Stk32b G A 5: 37,466,758 A215V probably damaging Het
Svil A T 18: 5,097,545 Y1676F probably damaging Het
Tanc1 G A 2: 59,791,679 V381M probably damaging Het
Tanc2 T C 11: 105,886,386 F797L probably benign Het
Tas2r120 T G 6: 132,657,601 C215W probably benign Het
Tenm4 G A 7: 96,895,940 D2388N probably damaging Het
Thsd4 C T 9: 60,056,937 S64N probably damaging Het
Thsd7b C T 1: 129,758,610 R630C probably damaging Het
Top3a A G 11: 60,759,362 I145T probably damaging Het
Vmn2r78 A G 7: 86,920,787 D171G probably benign Het
Vmn2r82 A G 10: 79,379,212 E343G probably benign Het
Wdr70 T C 15: 8,079,179 D161G probably benign Het
Other mutations in Slc39a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02004:Slc39a7 APN 17 34031121 unclassified probably benign
R0313:Slc39a7 UTSW 17 34029544 missense probably damaging 1.00
R0326:Slc39a7 UTSW 17 34028950 missense probably damaging 1.00
R0496:Slc39a7 UTSW 17 34029538 missense probably damaging 1.00
R2276:Slc39a7 UTSW 17 34031267 unclassified probably benign
R5065:Slc39a7 UTSW 17 34031059 unclassified probably benign
R5753:Slc39a7 UTSW 17 34030176 missense probably damaging 1.00
R6720:Slc39a7 UTSW 17 34030108 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTTCCAAAAGCAACAACGCTG -3'
(R):5'- CAATTGGAGCATTGGCAGGC -3'

Sequencing Primer
(F):5'- CAACAACGCTGCTGGGC -3'
(R):5'- TGTGCCCTTCTCACCGAGG -3'
Posted On2014-06-23